MU44038 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GCCCCACTACTCTCCTCTCCTTCTTCTAACCATTTGGATTTTGATCAGTGCTTCCACACAAATTCCCCTCCTTTTGGAGAAGGAGAATTCGACCATCCATCAATGGCGTCTTCCAATCCTACTACTAGGGCTTTCAAAGCTCTCTTCACCATCTTCTCTCTCATCTTCTTCATTCTTTCTCCACTCGTTGACGCCGCAGCACCTGCTCCCGCTCCCGCTCCCGCTCCCGCTCCCGCTCCCGCTAGCGACGGTATCTACCTACATTCCTTGTTTATGCATTCTCCTTCTCTTCTTTGTTGATTGATACTGAGTAAACTAGGTCTTGCTTTCAAATTATTAGGGTTAGGGATTTCTGTTGTGAGAAAAATAAGGGAATAATGTTTTGATTTTGTAATTGTGAAAACAGGGACCTCCATTGATCAGGGGATTGCGTACGTTCTGATGCTAGTGGCGTTGGTTCTCACGTATCTAATTCACCCTCTCGATGCATCTTTCTTACAATTTTTTTCTGAATTGAATTGAATTCTTCTTCCTAGGATTGTAGCAATGTAGGCGTTGTTTGTGGACGTTTGAGAAGGAACGAGAACCATTTATTCTTCTCTCTTTTTGTGATAAAATCAAAAGTGTATATTTGGGTTCCACAGATTTTGATCAATTGCTCCATTTAATTCATTGTTTATTC
BLAST of MU44038 vs. Swiss-Prot
Match: AGP16_ARATH (Arabinogalactan peptide 16 OS=Arabidopsis thaliana GN=AGP16 PE=1 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 4.1e-07 Identity = 27/29 (93.10%), Postives = 27/29 (93.10%), Query Frame = 1
BLAST of MU44038 vs. Swiss-Prot
Match: AGP20_ARATH (Arabinogalactan peptide 20 OS=Arabidopsis thaliana GN=AGP20 PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 4.1e-07 Identity = 27/29 (93.10%), Postives = 27/29 (93.10%), Query Frame = 1
BLAST of MU44038 vs. TrEMBL
Match: A0A061DUP4_THECC (Arabinogalactan protein 20 OS=Theobroma cacao GN=TCM_005200 PE=4 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 8.3e-07 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. TrEMBL
Match: W9S2G2_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_003071 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 1.1e-06 Identity = 30/34 (88.24%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. TrEMBL
Match: A0A0D2TCU0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G105900 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 1.1e-06 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. TrEMBL
Match: A5BTA7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_15s0046g01360 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.8e-06 Identity = 30/34 (88.24%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. TrEMBL
Match: A0A0A0L7A0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G120410 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.8e-06 Identity = 30/34 (88.24%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. TAIR10
Match: AT2G46330.1 (AT2G46330.1 arabinogalactan protein 16) HSP 1 Score: 56.6 bits (135), Expect = 2.3e-08 Identity = 27/29 (93.10%), Postives = 27/29 (93.10%), Query Frame = 1
BLAST of MU44038 vs. TAIR10
Match: AT3G61640.1 (AT3G61640.1 arabinogalactan protein 20) HSP 1 Score: 56.6 bits (135), Expect = 2.3e-08 Identity = 27/29 (93.10%), Postives = 27/29 (93.10%), Query Frame = 1
BLAST of MU44038 vs. TAIR10
Match: AT5G24105.1 (AT5G24105.1 arabinogalactan protein 41) HSP 1 Score: 48.1 bits (113), Expect = 8.2e-06 Identity = 23/24 (95.83%), Postives = 22/24 (91.67%), Query Frame = 1
BLAST of MU44038 vs. NCBI nr
Match: gi|1009143676|ref|XP_015889389.1| (PREDICTED: arabinogalactan peptide 20-like [Ziziphus jujuba]) HSP 1 Score: 60.1 bits (144), Expect = 5.9e-06 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. NCBI nr
Match: gi|720033434|ref|XP_010266430.1| (PREDICTED: arabinogalactan peptide 20-like [Nelumbo nucifera]) HSP 1 Score: 60.1 bits (144), Expect = 5.9e-06 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. NCBI nr
Match: gi|590721494|ref|XP_007051629.1| (Arabinogalactan protein 20 [Theobroma cacao]) HSP 1 Score: 60.1 bits (144), Expect = 5.9e-06 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. NCBI nr
Match: gi|703148852|ref|XP_010109451.1| (hypothetical protein L484_003071 [Morus notabilis]) HSP 1 Score: 59.7 bits (143), Expect = 7.7e-06 Identity = 30/34 (88.24%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of MU44038 vs. NCBI nr
Match: gi|823187080|ref|XP_012490068.1| (PREDICTED: arabinogalactan peptide 20-like [Gossypium raimondii]) HSP 1 Score: 59.7 bits (143), Expect = 7.7e-06 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|