CU178128 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCGACGTCAAAATGAGAGCTTTAGTAAAGACCGAATACACATAAGTATTTCTAAACTTTCACCTTTCGTTCAACTCCAATACTCTAATACCATGTCTTCCTCTCCTAAATTATTTCAAAACCCATATTTCTGTTCCTCAAAATTGAGTCCCAGATCCTTTCCATTTCTTCTTTCACAACTTTATTTGGCTCTTATACTGCTTATTCTGCTCTTTTCTGCTCCTGTTAATTCCTCTGTTTATGATGAATGGTTCTTCAACTGCAATTCCTTCAAATGCGACCCCTTTGTTACCAAGGAATTTCCTTTCTGGAGATACAACGGAACAGAAACTTGTTATCGTGTAGGTTACTCCGAGTCAATGAAGCTTACATGTGATGGAGACCGTGAAACCATAGA
BLAST of CU178128 vs. TrEMBL
Match: A0A0A0LQE7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042470 PE=4 SV=1) HSP 1 Score: 167.5 bits (423), Expect = 1.1e-38 Identity = 77/96 (80.21%), Postives = 77/96 (80.21%), Query Frame = 2
BLAST of CU178128 vs. TrEMBL
Match: A0A0A0LQ35_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G404850 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.1e-06 Identity = 31/58 (53.45%), Postives = 35/58 (60.34%), Query Frame = 2
BLAST of CU178128 vs. NCBI nr
Match: gi|700209039|gb|KGN64135.1| (hypothetical protein Csa_1G042470 [Cucumis sativus]) HSP 1 Score: 166.4 bits (420), Expect = 3.4e-38 Identity = 77/96 (80.21%), Postives = 77/96 (80.21%), Query Frame = 2
BLAST of CU178128 vs. NCBI nr
Match: gi|659066768|ref|XP_008460391.1| (PREDICTED: uncharacterized protein LOC103499200 isoform X1 [Cucumis melo]) HSP 1 Score: 140.2 bits (352), Expect = 2.6e-30 Identity = 69/110 (62.73%), Postives = 75/110 (68.18%), Query Frame = 2
BLAST of CU178128 vs. NCBI nr
Match: gi|659066772|ref|XP_008460514.1| (PREDICTED: uncharacterized protein LOC103499200 isoform X2 [Cucumis melo]) HSP 1 Score: 140.2 bits (352), Expect = 2.6e-30 Identity = 69/110 (62.73%), Postives = 75/110 (68.18%), Query Frame = 2
BLAST of CU178128 vs. NCBI nr
Match: gi|700208015|gb|KGN63134.1| (hypothetical protein Csa_2G404850 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 1.2e-06 Identity = 31/58 (53.45%), Postives = 35/58 (60.34%), Query Frame = 2
BLAST of CU178128 vs. NCBI nr
Match: gi|778673100|ref|XP_011649927.1| (PREDICTED: probable serine/threonine-protein kinase At1g18390 isoform X2 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 1.2e-06 Identity = 31/58 (53.45%), Postives = 35/58 (60.34%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|