CU176306 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GACTCCTCCACCGCTATGTCCATTTTCTACGAGGGTTCCCTCCTCGGGTCGGCCCAGGTGGATGCCGGTTCGCAGCAGCCCCGGTCGTGTCAGGTTCTACGACTTCCAGCCCGGCTGGACGGCCTGAAACTGGCCCACCACGGCAGCCGGTTCATCTCCGACGTGGCGAAGCGAGAGA
BLAST of CU176306 vs. TrEMBL
Match: A0A0A0KGW5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G425170 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 1.6e-23 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 1
BLAST of CU176306 vs. TrEMBL
Match: W9QJ47_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_022324 PE=4 SV=1) HSP 1 Score: 97.8 bits (242), Expect = 4.6e-18 Identity = 47/58 (81.03%), Postives = 51/58 (87.93%), Query Frame = 1
BLAST of CU176306 vs. TrEMBL
Match: A0A0S3SBZ9_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.06G164300 PE=4 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 6.0e-18 Identity = 47/58 (81.03%), Postives = 52/58 (89.66%), Query Frame = 1
BLAST of CU176306 vs. TrEMBL
Match: A0A0L9V6C7_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan08g136500 PE=4 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 6.0e-18 Identity = 47/58 (81.03%), Postives = 52/58 (89.66%), Query Frame = 1
BLAST of CU176306 vs. TrEMBL
Match: M5WKP8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa021034mg PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 1.8e-17 Identity = 45/58 (77.59%), Postives = 53/58 (91.38%), Query Frame = 1
BLAST of CU176306 vs. NCBI nr
Match: gi|449444795|ref|XP_004140159.1| (PREDICTED: uncharacterized protein LOC101218134 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 2.3e-23 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 1
BLAST of CU176306 vs. NCBI nr
Match: gi|700192825|gb|KGN48029.1| (hypothetical protein Csa_6G425170 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 2.3e-23 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 1
BLAST of CU176306 vs. NCBI nr
Match: gi|659097347|ref|XP_008449575.1| (PREDICTED: uncharacterized protein LOC103491417 [Cucumis melo]) HSP 1 Score: 115.9 bits (289), Expect = 2.3e-23 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 1
BLAST of CU176306 vs. NCBI nr
Match: gi|703074400|ref|XP_010089808.1| (hypothetical protein L484_022324 [Morus notabilis]) HSP 1 Score: 97.8 bits (242), Expect = 6.6e-18 Identity = 47/58 (81.03%), Postives = 51/58 (87.93%), Query Frame = 1
BLAST of CU176306 vs. NCBI nr
Match: gi|950941629|ref|XP_014493446.1| (PREDICTED: uncharacterized protein LOC106755749 [Vigna radiata var. radiata]) HSP 1 Score: 97.4 bits (241), Expect = 8.6e-18 Identity = 47/58 (81.03%), Postives = 52/58 (89.66%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|