CU175748 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU175748
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr2 : 12438701 .. 12438770 (-)
Sequence length	76

The following sequences are available for this feature:

GGGCGTCATTCTAACCTCGTTTAAACGCATTCCGTTCGTTCTCCGACGGCTCTACATTTCTCTCCGCGTTTTCTCC


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa2G252060	Csa2G252060	gene
Csa2G252050	Csa2G252050	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0177671	H0177671	EST