CU174948 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGTCAATATCTCCGGACATTGTTACCCCGTATTCCGTCATTTATAGAGGAGGATAAGAGGAATATGAACAAAGCAGTCTAAGTCCAGCATTGTTGAGGAGGGCGAGGCAAAGAAGCATTGGCTGCATGAGAAAGAGCCTGTGGGAATCAAAA
BLAST of CU174948 vs. TrEMBL
Match: A0A0A0L0J2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G095560 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.5e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 3
BLAST of CU174948 vs. NCBI nr
Match: gi|449438835|ref|XP_004137193.1| (PREDICTED: uncharacterized protein LOC101221365 [Cucumis sativus]) HSP 1 Score: 59.3 bits (142), Expect = 2.2e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 3
BLAST of CU174948 vs. NCBI nr
Match: gi|659111130|ref|XP_008455593.1| (PREDICTED: 50S ribosomal protein L23, chloroplastic [Cucumis melo]) HSP 1 Score: 58.2 bits (139), Expect = 4.9e-06 Identity = 26/27 (96.30%), Postives = 27/27 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|