CU174717 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGTCCGAACAAAAATCTACGGAGAGTCTGAGTTTAGGAGAGGGTTGTCATGATCCGGAAATTAGTTGTAGTGCACACAAAGTGTGAAGATGAACGAATTGGATCAGAAAGTTGTGAATAATGGCCATGTTACTGGAGAAGATCAAACGGTCAATTGTAGGGTGATTCTTGTGTCCCAAGTTGCTGCAGCGTTGCATG
BLAST of CU174717 vs. TrEMBL
Match: A0A0A0M049_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G657500 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 3.6e-11 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = 1
BLAST of CU174717 vs. NCBI nr
Match: gi|700211578|gb|KGN66674.1| (hypothetical protein Csa_1G657500 [Cucumis sativus]) HSP 1 Score: 75.1 bits (183), Expect = 5.1e-11 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = 1
BLAST of CU174717 vs. NCBI nr
Match: gi|659086077|ref|XP_008443753.1| (PREDICTED: uncharacterized protein LOC103487266 [Cucumis melo]) HSP 1 Score: 64.7 bits (156), Expect = 6.9e-08 Identity = 34/39 (87.18%), Postives = 37/39 (94.87%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|