CU174373 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GACAGGTCTACCAACTTTAAGTCATAGGGTAGATGCTTTTCCTCCAAAGTGAGTAATACCCTCTGACAAAAAGGGCAGTCGCCGAGCTTGTTGGGTAGAGTAGTGGAAGCTTTGACGCAGGCTTCAAGAGGGGCAACAGACATGGAAACAGAGAGAGATCGTGCAGGTCCAGAGCGCCTGAAGGAGAATGAAAGAATGGGTAGAAAAAGGAGAAAGCGAGGAATTGGAAGGAAGTAGAAAACTAAAACCATATG
BLAST of CU174373 vs. Swiss-Prot
Match: DHAR3_ARATH (Glutathione S-transferase DHAR3, chloroplastic OS=Arabidopsis thaliana GN=DHAR3 PE=1 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 2.0e-15 Identity = 35/53 (66.04%), Postives = 45/53 (84.91%), Query Frame = -1
BLAST of CU174373 vs. Swiss-Prot
Match: DHAR4_ARATH (Putative glutathione S-transferase DHAR4 OS=Arabidopsis thaliana GN=DHAR4 PE=5 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 5.2e-08 Identity = 25/42 (59.52%), Postives = 31/42 (73.81%), Query Frame = -1
BLAST of CU174373 vs. Swiss-Prot
Match: DHAR1_ARATH (Glutathione S-transferase DHAR1, mitochondrial OS=Arabidopsis thaliana GN=DHAR1 PE=1 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.5e-07 Identity = 26/42 (61.90%), Postives = 29/42 (69.05%), Query Frame = -1
BLAST of CU174373 vs. Swiss-Prot
Match: DHAR2_ARATH (Glutathione S-transferase DHAR2 OS=Arabidopsis thaliana GN=DHAR2 PE=1 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.6e-07 Identity = 25/42 (59.52%), Postives = 29/42 (69.05%), Query Frame = -1
BLAST of CU174373 vs. TrEMBL
Match: A0A0H3U218_SIRGR (Dehydroascorbate reductase OS=Siraitia grosvenorii PE=2 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 1.0e-18 Identity = 47/56 (83.93%), Postives = 50/56 (89.29%), Query Frame = -1
BLAST of CU174373 vs. TrEMBL
Match: C0LQA2_MALDO (Dehydroascorbate reductase OS=Malus domestica PE=2 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.6e-16 Identity = 44/56 (78.57%), Postives = 50/56 (89.29%), Query Frame = -1
BLAST of CU174373 vs. TrEMBL
Match: A0A061EGD4_THECC (Dehydroascorbate reductase 1 isoform 2 OS=Theobroma cacao GN=TCM_019159 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.1e-16 Identity = 44/57 (77.19%), Postives = 48/57 (84.21%), Query Frame = -1
BLAST of CU174373 vs. TrEMBL
Match: A0A061EFZ7_THECC (Dehydroascorbate reductase 1 isoform 1 OS=Theobroma cacao GN=TCM_019159 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.1e-16 Identity = 44/57 (77.19%), Postives = 48/57 (84.21%), Query Frame = -1
BLAST of CU174373 vs. TrEMBL
Match: Q9FVE4_SPIOL (Dehydroascorbate reductase OS=Spinacia oleracea GN=DHAR PE=2 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 8.0e-16 Identity = 44/57 (77.19%), Postives = 49/57 (85.96%), Query Frame = -1
BLAST of CU174373 vs. NCBI nr
Match: gi|449456235|ref|XP_004145855.1| (PREDICTED: glutathione S-transferase DHAR3, chloroplastic [Cucumis sativus]) HSP 1 Score: 115.5 bits (288), Expect = 4.4e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = -1
BLAST of CU174373 vs. NCBI nr
Match: gi|659114326|ref|XP_008457014.1| (PREDICTED: glutathione S-transferase DHAR3, chloroplastic [Cucumis melo]) HSP 1 Score: 110.2 bits (274), Expect = 1.8e-21 Identity = 54/56 (96.43%), Postives = 54/56 (96.43%), Query Frame = -1
BLAST of CU174373 vs. NCBI nr
Match: gi|595333702|gb|AHM26862.1| (dehydroascorbate reductase [Siraitia grosvenorii]) HSP 1 Score: 100.1 bits (248), Expect = 1.9e-18 Identity = 47/56 (83.93%), Postives = 50/56 (89.29%), Query Frame = -1
BLAST of CU174373 vs. NCBI nr
Match: gi|694412206|ref|XP_009334436.1| (PREDICTED: glutathione S-transferase DHAR3, chloroplastic-like [Pyrus x bretschneideri]) HSP 1 Score: 95.9 bits (237), Expect = 3.6e-17 Identity = 46/56 (82.14%), Postives = 51/56 (91.07%), Query Frame = -1
BLAST of CU174373 vs. NCBI nr
Match: gi|658053505|ref|XP_008362508.1| (PREDICTED: glutathione S-transferase DHAR3, chloroplastic-like [Malus domestica]) HSP 1 Score: 95.9 bits (237), Expect = 3.6e-17 Identity = 46/56 (82.14%), Postives = 51/56 (91.07%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|