CU173286 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GACCTCTACGATCAGGACCGTAACGGCCTTATTTTCTTCTAGTTCCGAGCTCCATCTCGTTCTCAATCGCCTCGGAATCAGTTGTTCTAAGGAAGACTGTCAAAAAATGATCAACTCCGTTGATTCGGATGGAGACGGAAATGTGAATTTCGAAAGAGTTTTAAGGAAGATGATGACGGATAATTCCAAATCGAAGGCCGCTCAAACAGAAACGGAACTGCCGCGGCGCACCCTAGCCCTAA
BLAST of CU173286 vs. Swiss-Prot
Match: CML27_ARATH (Probable calcium-binding protein CML27 OS=Arabidopsis thaliana GN=CML27 PE=1 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 3.3e-12 Identity = 39/63 (61.90%), Postives = 42/63 (66.67%), Query Frame = 2
BLAST of CU173286 vs. Swiss-Prot
Match: CML26_ARATH (Probable calcium-binding protein CML26 OS=Arabidopsis thaliana GN=CML26 PE=1 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.1e-10 Identity = 32/47 (68.09%), Postives = 37/47 (78.72%), Query Frame = 2
BLAST of CU173286 vs. Swiss-Prot
Match: CML23_ARATH (Probable calcium-binding protein CML23 OS=Arabidopsis thaliana GN=CML23 PE=2 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 7.6e-09 Identity = 28/50 (56.00%), Postives = 34/50 (68.00%), Query Frame = 2
BLAST of CU173286 vs. Swiss-Prot
Match: ALL8_OLEEU (Calcium-binding allergen Ole e 8 OS=Olea europaea PE=1 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.4e-07 Identity = 29/50 (58.00%), Postives = 34/50 (68.00%), Query Frame = 2
BLAST of CU173286 vs. Swiss-Prot
Match: CML24_ARATH (Calcium-binding protein CML24 OS=Arabidopsis thaliana GN=CML24 PE=2 SV=2) HSP 1 Score: 55.1 bits (131), Expect = 4.2e-07 Identity = 26/48 (54.17%), Postives = 33/48 (68.75%), Query Frame = 2
BLAST of CU173286 vs. TrEMBL
Match: A0A0A0LPP8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025020 PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 2.5e-19 Identity = 52/56 (92.86%), Postives = 52/56 (92.86%), Query Frame = 2
BLAST of CU173286 vs. TrEMBL
Match: V4KYC9_EUTSA (Uncharacterized protein OS=Eutrema salsugineum GN=EUTSA_v10008945mg PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 3.7e-10 Identity = 35/50 (70.00%), Postives = 41/50 (82.00%), Query Frame = 2
BLAST of CU173286 vs. TrEMBL
Match: M4EAW5_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.8e-10 Identity = 35/50 (70.00%), Postives = 41/50 (82.00%), Query Frame = 2
BLAST of CU173286 vs. TrEMBL
Match: A0A0D3CB55_BRAOL (Uncharacterized protein OS=Brassica oleracea var. oleracea PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.8e-10 Identity = 35/50 (70.00%), Postives = 41/50 (82.00%), Query Frame = 2
BLAST of CU173286 vs. TrEMBL
Match: A0A078G1L6_BRANA (BnaC05g13970D protein OS=Brassica napus GN=BnaC05g13970D PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.8e-10 Identity = 35/50 (70.00%), Postives = 41/50 (82.00%), Query Frame = 2
BLAST of CU173286 vs. NCBI nr
Match: gi|449439129|ref|XP_004137340.1| (PREDICTED: probable calcium-binding protein CML27 [Cucumis sativus]) HSP 1 Score: 99.8 bits (247), Expect = 2.4e-18 Identity = 52/56 (92.86%), Postives = 52/56 (92.86%), Query Frame = 2
BLAST of CU173286 vs. NCBI nr
Match: gi|659106947|ref|XP_008453475.1| (PREDICTED: probable calcium-binding protein CML27 [Cucumis melo]) HSP 1 Score: 98.2 bits (243), Expect = 6.9e-18 Identity = 51/56 (91.07%), Postives = 52/56 (92.86%), Query Frame = 2
BLAST of CU173286 vs. NCBI nr
Match: gi|1009165393|ref|XP_015901010.1| (PREDICTED: probable calcium-binding protein CML27 [Ziziphus jujuba]) HSP 1 Score: 70.5 bits (171), Expect = 1.5e-09 Identity = 35/52 (67.31%), Postives = 42/52 (80.77%), Query Frame = 2
BLAST of CU173286 vs. NCBI nr
Match: gi|470127141|ref|XP_004299534.1| (PREDICTED: probable calcium-binding protein CML27 [Fragaria vesca subsp. vesca]) HSP 1 Score: 70.1 bits (170), Expect = 2.0e-09 Identity = 35/54 (64.81%), Postives = 43/54 (79.63%), Query Frame = 2
BLAST of CU173286 vs. NCBI nr
Match: gi|1021495528|ref|XP_016190781.1| (PREDICTED: probable calcium-binding protein CML26 [Arachis ipaensis]) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 34/49 (69.39%), Postives = 41/49 (83.67%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|