CU172492 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCAATCCCAGCTCCACCACATGCCCCGCCTCGACTACCTCCGCCGCTGCCGTGACCACTCCATCGACCTCACTGCCCGTCAAGACTCCATCAACTGGATCTTGATGGTTCTCTCCCACTACAATTTCAAACCGGTGACTGCGATTCTCTCTGTTAATTACTTTGATCGCTTCCTCTCCTCCAATATTCTTCCACGGCGAAATGGATGGGCGTTTCAGCTTCTA
BLAST of CU172492 vs. Swiss-Prot
Match: CCD11_ARATH (Cyclin-D1-1 OS=Arabidopsis thaliana GN=CYCD1-1 PE=1 SV=3) HSP 1 Score: 82.8 bits (203), Expect = 1.7e-15 Identity = 37/74 (50.00%), Postives = 50/74 (67.57%), Query Frame = 2
BLAST of CU172492 vs. Swiss-Prot
Match: CCD21_ORYSJ (Cyclin-D2-1 OS=Oryza sativa subsp. japonica GN=CYCD2-1 PE=3 SV=2) HSP 1 Score: 75.1 bits (183), Expect = 3.6e-13 Identity = 37/72 (51.39%), Postives = 43/72 (59.72%), Query Frame = 2
BLAST of CU172492 vs. Swiss-Prot
Match: CCD41_ORYSJ (Cyclin-D4-1 OS=Oryza sativa subsp. japonica GN=CYCD4-1 PE=2 SV=2) HSP 1 Score: 73.2 bits (178), Expect = 1.4e-12 Identity = 38/78 (48.72%), Postives = 46/78 (58.97%), Query Frame = 2
BLAST of CU172492 vs. Swiss-Prot
Match: CCD12_ORYSJ (Cyclin-D1-2 OS=Oryza sativa subsp. japonica GN=CYCD1-2 PE=3 SV=2) HSP 1 Score: 69.3 bits (168), Expect = 2.0e-11 Identity = 39/75 (52.00%), Postives = 44/75 (58.67%), Query Frame = 2
BLAST of CU172492 vs. Swiss-Prot
Match: CCD42_ORYSJ (Cyclin-D4-2 OS=Oryza sativa subsp. japonica GN=CYCD4-2 PE=2 SV=2) HSP 1 Score: 69.3 bits (168), Expect = 2.0e-11 Identity = 36/71 (50.70%), Postives = 40/71 (56.34%), Query Frame = 2
BLAST of CU172492 vs. TrEMBL
Match: A0A0A0KSY9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G000660 PE=3 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 5.2e-35 Identity = 73/74 (98.65%), Postives = 73/74 (98.65%), Query Frame = 2
BLAST of CU172492 vs. TrEMBL
Match: E5GBG8_CUCME (Cyclin d protein OS=Cucumis melo subsp. melo PE=3 SV=1) HSP 1 Score: 149.1 bits (375), Expect = 2.2e-33 Identity = 69/74 (93.24%), Postives = 72/74 (97.30%), Query Frame = 2
BLAST of CU172492 vs. TrEMBL
Match: A0A0D2SM42_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G230300 PE=3 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 3.9e-22 Identity = 50/73 (68.49%), Postives = 60/73 (82.19%), Query Frame = 2
BLAST of CU172492 vs. TrEMBL
Match: A0A067LJP7_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_16352 PE=3 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.5e-21 Identity = 50/73 (68.49%), Postives = 60/73 (82.19%), Query Frame = 2
BLAST of CU172492 vs. TrEMBL
Match: A0A0B0P1H1_GOSAR (Cyclin-D1-1-like protein OS=Gossypium arboreum GN=F383_24431 PE=3 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 1.9e-21 Identity = 49/73 (67.12%), Postives = 59/73 (80.82%), Query Frame = 2
BLAST of CU172492 vs. NCBI nr
Match: gi|449465087|ref|XP_004150260.1| (PREDICTED: cyclin-D4-1-like [Cucumis sativus]) HSP 1 Score: 154.8 bits (390), Expect = 5.7e-35 Identity = 73/74 (98.65%), Postives = 73/74 (98.65%), Query Frame = 2
BLAST of CU172492 vs. NCBI nr
Match: gi|659108835|ref|XP_008454410.1| (PREDICTED: cyclin-D4-2-like [Cucumis melo]) HSP 1 Score: 149.4 bits (376), Expect = 2.4e-33 Identity = 69/74 (93.24%), Postives = 72/74 (97.30%), Query Frame = 2
BLAST of CU172492 vs. NCBI nr
Match: gi|823160558|ref|XP_012480123.1| (PREDICTED: cyclin-D1-1-like [Gossypium raimondii]) HSP 1 Score: 112.5 bits (280), Expect = 3.3e-22 Identity = 50/73 (68.49%), Postives = 60/73 (82.19%), Query Frame = 2
BLAST of CU172492 vs. NCBI nr
Match: gi|802550741|ref|XP_012093144.1| (PREDICTED: cyclin-D4-1-like isoform X1 [Jatropha curcas]) HSP 1 Score: 110.5 bits (275), Expect = 1.2e-21 Identity = 50/73 (68.49%), Postives = 60/73 (82.19%), Query Frame = 2
BLAST of CU172492 vs. NCBI nr
Match: gi|728839289|gb|KHG18732.1| (Cyclin-D1-1 -like protein [Gossypium arboreum]) HSP 1 Score: 110.2 bits (274), Expect = 1.6e-21 Identity = 49/73 (67.12%), Postives = 59/73 (80.82%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|