|
|
| Name | CU171942 |
|---|
| Type | transcribed_cluster |
|---|
| Organism | Cucumis. sativus (Cucumber (Chinese Long) v2) |
|---|
| Description | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family |
|---|
| Location | Chr6 : 19901084 .. 19901202 (+) |
|---|
| Sequence length | 117 |
|---|
The following sequences are available for this feature:
transcribed_cluster sequence TTTTGCGAGAGGTGCTGTGGTGGAGTCACAAATTCAAGGTCCACGTGGACAGCCATCTCACCGTTGATCCCGTTTCCTTGATGTCCTTGATCAGGAAAACCTTCTCAACTTGAGCTC
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
| Feature Name | Unique Name | Type |
|---|
| H0150036 | H0150036 | EST |
|
