CU171843 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGGGAAAAACCCTACTACACCTTCTCCTCCCTTTTATTTTTGTTTTGATTTTTCCCTCACCCATCATTATTCGTATCGTCCTTGCAGCGGAAGATTTTTGAAGCTTGACTCATGGATCCTCAACCCGAGCCAGTCAGCTACATCTGTGGAGATTGTGGAATGGAGAACACTCTGAAGCAGGGTGATGTTAACAGTGCCGGGAGTGTGGTTATCG
BLAST of CU171843 vs. Swiss-Prot
Match: NRPBC_ARATH (DNA-directed RNA polymerases II, IV and V subunit 12 OS=Arabidopsis thaliana GN=NRPB12 PE=1 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 8.2e-07 Identity = 21/26 (80.77%), Postives = 21/26 (80.77%), Query Frame = 2
BLAST of CU171843 vs. TrEMBL
Match: A0A0A0LQM4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043180 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 4.4e-07 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = 2
BLAST of CU171843 vs. TrEMBL
Match: B9SNE7_RICCO (DNA-directed RNA polymerases I, II, and III 7.0 kDa polypeptide, putative OS=Ricinus communis GN=RCOM_0175610 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 4.4e-07 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = 2
BLAST of CU171843 vs. TrEMBL
Match: A0A022RDU6_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a017594mg PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.7e-06 Identity = 25/26 (96.15%), Postives = 25/26 (96.15%), Query Frame = 2
BLAST of CU171843 vs. TrEMBL
Match: A0A0S3TBL1_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.11G212200 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.2e-06 Identity = 25/26 (96.15%), Postives = 25/26 (96.15%), Query Frame = 2
BLAST of CU171843 vs. TrEMBL
Match: A0A067L7U6_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_16325 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.2e-06 Identity = 25/26 (96.15%), Postives = 25/26 (96.15%), Query Frame = 2
BLAST of CU171843 vs. NCBI nr
Match: gi|223533156|gb|EEF34914.1| (DNA-directed RNA polymerases I, II, and III 7.0 kDa polypeptide, putative [Ricinus communis]) HSP 1 Score: 62.8 bits (151), Expect = 2.8e-07 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = 2
BLAST of CU171843 vs. NCBI nr
Match: gi|1000949640|ref|XP_015579873.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 12 [Ricinus communis]) HSP 1 Score: 62.8 bits (151), Expect = 2.8e-07 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = 2
BLAST of CU171843 vs. NCBI nr
Match: gi|848871798|ref|XP_012836463.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 12 [Erythranthe guttata]) HSP 1 Score: 60.8 bits (146), Expect = 1.1e-06 Identity = 25/26 (96.15%), Postives = 25/26 (96.15%), Query Frame = 2
BLAST of CU171843 vs. NCBI nr
Match: gi|1012360239|gb|KYP71423.1| (DNA-directed RNA polymerases I, II, and III subunit RPABC4 [Cajanus cajan]) HSP 1 Score: 60.5 bits (145), Expect = 1.4e-06 Identity = 25/26 (96.15%), Postives = 25/26 (96.15%), Query Frame = 2
BLAST of CU171843 vs. NCBI nr
Match: gi|734310026|gb|KHM99727.1| (DNA-directed RNA polymerases I, II, and III subunit RPABC4 [Glycine soja]) HSP 1 Score: 60.5 bits (145), Expect = 1.4e-06 Identity = 25/26 (96.15%), Postives = 25/26 (96.15%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|