CU171182 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATCGAGAGCATCCTCCACGGTACTTTGTAACTTGGTATTGGAGTTGTTAGGGTCGTAACCAAACTTCCTTGTCTCCACAGGAAATAGCTCCTCGTACTTCATACGCTTAGCCGCGTCAATAGTATACATTGCTCCGTCTCCATCTTCTACACCATCAGCCGATGTCAAAATCTCGCCATCGTCCGTGGGGTTCTCGTCGGTCTTACTTTTGTTCTTTTCTTCTTCTTCTTCTTCTTCTTAAGTAACAAA
BLAST of CU171182 vs. TrEMBL
Match: W5B888_WHEAT (Uncharacterized protein OS=Triticum aestivum PE=4 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.4e-12 Identity = 45/75 (60.00%), Postives = 50/75 (66.67%), Query Frame = -1
BLAST of CU171182 vs. TrEMBL
Match: A0A0E0DH93_9ORYZ (Uncharacterized protein OS=Oryza meridionalis PE=4 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.4e-12 Identity = 42/76 (55.26%), Postives = 52/76 (68.42%), Query Frame = -1
BLAST of CU171182 vs. TrEMBL
Match: I1J0M8_BRADI (Uncharacterized protein OS=Brachypodium distachyon GN=BRADI_5g18510 PE=4 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.4e-12 Identity = 47/77 (61.04%), Postives = 51/77 (66.23%), Query Frame = -1
BLAST of CU171182 vs. TrEMBL
Match: Q0JAZ6_ORYSJ (Os04g0566000 protein (Fragment) OS=Oryza sativa subsp. japonica GN=Os04g0566000 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.1e-12 Identity = 42/78 (53.85%), Postives = 52/78 (66.67%), Query Frame = -1
BLAST of CU171182 vs. TrEMBL
Match: A2XWI0_ORYSI (Putative uncharacterized protein OS=Oryza sativa subsp. indica GN=OsI_17008 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.1e-12 Identity = 42/78 (53.85%), Postives = 52/78 (66.67%), Query Frame = -1
BLAST of CU171182 vs. NCBI nr
Match: gi|778656758|ref|XP_004137395.2| (PREDICTED: uncharacterized protein LOC101213981 [Cucumis sativus]) HSP 1 Score: 136.0 bits (341), Expect = 3.1e-29 Identity = 68/72 (94.44%), Postives = 70/72 (97.22%), Query Frame = -1
BLAST of CU171182 vs. NCBI nr
Match: gi|659066319|ref|XP_008438568.1| (PREDICTED: uncharacterized protein LOC103483601 [Cucumis melo]) HSP 1 Score: 131.3 bits (329), Expect = 7.6e-28 Identity = 66/72 (91.67%), Postives = 69/72 (95.83%), Query Frame = -1
BLAST of CU171182 vs. NCBI nr
Match: gi|672188899|ref|XP_008813699.1| (PREDICTED: uncharacterized protein LOC103724269 [Phoenix dactylifera]) HSP 1 Score: 79.0 bits (193), Expect = 4.5e-12 Identity = 41/72 (56.94%), Postives = 49/72 (68.06%), Query Frame = -1
BLAST of CU171182 vs. NCBI nr
Match: gi|743883663|ref|XP_010909478.1| (PREDICTED: uncharacterized protein LOC105035576 [Elaeis guineensis]) HSP 1 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 40/72 (55.56%), Postives = 48/72 (66.67%), Query Frame = -1
BLAST of CU171182 vs. NCBI nr
Match: gi|357165305|ref|XP_003580338.1| (PREDICTED: uncharacterized protein LOC100826306 [Brachypodium distachyon]) HSP 1 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 47/77 (61.04%), Postives = 51/77 (66.23%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|