CU171073 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTACTCTTCTTCATGTATTTCCTTCTACAAGATCCAAAGGTAGTTCCAAAGTTCGTAATCGCCGATTGAATGGCTATCAATTGGCCCTAACTTTCAGAGACCTCTGTAACACTTTCCCTAATACAAAGGTAGAAATTGTTGTGACGGAAGGCGATCAAGAAGGTAGAAAGATCACGGCCATTGTTAGAGAAATTGGAGCTTCTGTGCTTGTAGTTGGACTCCATAGCCATAGCTTTCTATACAAGATGGCTATGGAGGAAAAG
BLAST of CU171073 vs. TrEMBL
Match: A0A0A0LQQ9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042150 PE=4 SV=1) HSP 1 Score: 171.4 bits (433), Expect = 4.9e-40 Identity = 86/88 (97.73%), Postives = 87/88 (98.86%), Query Frame = 1
BLAST of CU171073 vs. TrEMBL
Match: W9S674_9ROSA (Putative AC transposase OS=Morus notabilis GN=L484_022285 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.6e-27 Identity = 67/88 (76.14%), Postives = 75/88 (85.23%), Query Frame = 1
BLAST of CU171073 vs. TrEMBL
Match: M5WBX5_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011515mg PE=4 SV=1) HSP 1 Score: 127.5 bits (319), Expect = 8.1e-27 Identity = 58/85 (68.24%), Postives = 74/85 (87.06%), Query Frame = 1
BLAST of CU171073 vs. TrEMBL
Match: A0A068C5G1_CATRO (Putative universal stress protein OS=Catharanthus roseus PE=2 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 6.9e-26 Identity = 62/86 (72.09%), Postives = 71/86 (82.56%), Query Frame = 1
BLAST of CU171073 vs. TrEMBL
Match: A0A0L9UB38_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan04g033800 PE=4 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 1.2e-25 Identity = 60/85 (70.59%), Postives = 71/85 (83.53%), Query Frame = 1
BLAST of CU171073 vs. NCBI nr
Match: gi|449439683|ref|XP_004137615.1| (PREDICTED: uncharacterized protein LOC101206357 [Cucumis sativus]) HSP 1 Score: 172.6 bits (436), Expect = 3.2e-40 Identity = 86/88 (97.73%), Postives = 87/88 (98.86%), Query Frame = 1
BLAST of CU171073 vs. NCBI nr
Match: gi|659066685|ref|XP_008456196.1| (PREDICTED: uncharacterized protein LOC103496179 [Cucumis melo]) HSP 1 Score: 168.3 bits (425), Expect = 5.9e-39 Identity = 83/88 (94.32%), Postives = 85/88 (96.59%), Query Frame = 1
BLAST of CU171073 vs. NCBI nr
Match: gi|1009131850|ref|XP_015883065.1| (PREDICTED: uncharacterized protein LOC107418888 [Ziziphus jujuba]) HSP 1 Score: 135.2 bits (339), Expect = 5.6e-29 Identity = 63/85 (74.12%), Postives = 75/85 (88.24%), Query Frame = 1
BLAST of CU171073 vs. NCBI nr
Match: gi|470130380|ref|XP_004301081.1| (PREDICTED: uncharacterized protein LOC101313612 [Fragaria vesca subsp. vesca]) HSP 1 Score: 131.0 bits (328), Expect = 1.1e-27 Identity = 61/87 (70.11%), Postives = 76/87 (87.36%), Query Frame = 1
BLAST of CU171073 vs. NCBI nr
Match: gi|460379971|ref|XP_004235732.1| (PREDICTED: uncharacterized protein LOC101257549 [Solanum lycopersicum]) HSP 1 Score: 130.6 bits (327), Expect = 1.4e-27 Identity = 60/86 (69.77%), Postives = 75/86 (87.21%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|