CU169915 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTTAGACTAGACCGTAATAAGTTGATGGTGGACGTCGTGATATGCAGTATTGTTGCGAAATAAGATGTGGAAGAGATTACCAGGCAGCCATAATCCACAGTGATCGTCTACCGTCTTAATAGTGGCAAAAGGAAAAGAAGAAGATGGAGATTCTAGGAGTCATACCAGATGCTAAAAATGACCAACGCCCCACCAAATCGTGTCAAGCAGTA
BLAST of CU169915 vs. Swiss-Prot
Match: SBH1_ARATH (Sphinganine C4-monooxygenase 1 OS=Arabidopsis thaliana GN=SBH1 PE=1 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 1.8e-14 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = -3
HSP 2 Score: 35.4 bits (80), Expect = 3.0e-01 Identity = 16/21 (76.19%), Postives = 15/21 (71.43%), Query Frame = -2
BLAST of CU169915 vs. Swiss-Prot
Match: SBH2_ARATH (Sphinganine C4-monooxygenase 2 OS=Arabidopsis thaliana GN=SBH2 PE=1 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.2e-13 Identity = 32/36 (88.89%), Postives = 31/36 (86.11%), Query Frame = -3
HSP 2 Score: 33.5 bits (75), Expect = 1.1e+00 Identity = 15/21 (71.43%), Postives = 15/21 (71.43%), Query Frame = -2
BLAST of CU169915 vs. Swiss-Prot
Match: SUR2_YEAST (Sphingolipid C4-hydroxylase SUR2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=SUR2 PE=1 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 8.1e-07 Identity = 23/35 (65.71%), Postives = 24/35 (68.57%), Query Frame = -3
BLAST of CU169915 vs. TrEMBL
Match: A0A0A0LJX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G101090 PE=3 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 4.8e-14 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = -3
BLAST of CU169915 vs. TrEMBL
Match: A0A0A0LJX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G101090 PE=3 SV=1) HSP 1 Score: 40.4 bits (93), Expect = 1.0e+00 Identity = 19/21 (90.48%), Postives = 19/21 (90.48%), Query Frame = -2
HSP 2 Score: 81.6 bits (200), Expect = 4.1e-13 Identity = 33/36 (91.67%), Postives = 35/36 (97.22%), Query Frame = -3
BLAST of CU169915 vs. TrEMBL
Match: A0A059D8M5_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_B03436 PE=3 SV=1) HSP 1 Score: 35.0 bits (79), Expect = 4.4e+01 Identity = 16/21 (76.19%), Postives = 17/21 (80.95%), Query Frame = -2
HSP 2 Score: 81.6 bits (200), Expect = 4.1e-13 Identity = 33/36 (91.67%), Postives = 35/36 (97.22%), Query Frame = -3
BLAST of CU169915 vs. TrEMBL
Match: A0A0M4C3W6_JATCU (Sterol desaturase (Fragment) OS=Jatropha curcas PE=2 SV=1) HSP 1 Score: 34.7 bits (78), Expect = 5.7e+01 Identity = 16/21 (76.19%), Postives = 17/21 (80.95%), Query Frame = -2
HSP 2 Score: 81.6 bits (200), Expect = 4.1e-13 Identity = 33/36 (91.67%), Postives = 35/36 (97.22%), Query Frame = -3
BLAST of CU169915 vs. TrEMBL
Match: A0A067LAS4_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_15596 PE=3 SV=1) HSP 1 Score: 34.7 bits (78), Expect = 5.7e+01 Identity = 16/21 (76.19%), Postives = 17/21 (80.95%), Query Frame = -2
HSP 2 Score: 81.6 bits (200), Expect = 4.1e-13 Identity = 33/36 (91.67%), Postives = 35/36 (97.22%), Query Frame = -3
BLAST of CU169915 vs. NCBI nr
Match: gi|449442297|ref|XP_004138918.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Cucumis sativus]) HSP 1 Score: 86.7 bits (213), Expect = 1.8e-14 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = -3
BLAST of CU169915 vs. NCBI nr
Match: gi|700206260|gb|KGN61379.1| (hypothetical protein Csa_2G101090 [Cucumis sativus]) HSP 1 Score: 86.7 bits (213), Expect = 1.8e-14 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = -3
BLAST of CU169915 vs. NCBI nr
Match: gi|659082180|ref|XP_008441706.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Cucumis melo]) HSP 1 Score: 86.3 bits (212), Expect = 2.4e-14 Identity = 35/36 (97.22%), Postives = 36/36 (100.00%), Query Frame = -3
BLAST of CU169915 vs. NCBI nr
Match: gi|470122555|ref|XP_004297306.1| (PREDICTED: sphinganine C(4)-monooxygenase 1 [Fragaria vesca subsp. vesca]) HSP 1 Score: 86.3 bits (212), Expect = 2.4e-14 Identity = 35/36 (97.22%), Postives = 36/36 (100.00%), Query Frame = -3
BLAST of CU169915 vs. NCBI nr
Match: gi|694361203|ref|XP_009360346.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Pyrus x bretschneideri]) HSP 1 Score: 84.7 bits (208), Expect = 6.9e-14 Identity = 35/36 (97.22%), Postives = 35/36 (97.22%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|