CU169810 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCTTTTGGAGGGCTTCAAAGTTGCCTTGTGTCTATCAGGTACATTGTTTTTCTTCACTCTATGCTCAGCAACACAAGCTTGAACTTTGCACATCAGCATTTCATTTTGTGCTTTGAGATCATTAACATGCTCTTCCATTCCGTGCAATTGTTGAACCGTCCTTGCTAGCTCCTTCGACGATGATCTCCTTC
BLAST of CU169810 vs. TrEMBL
Match: A0A0A0LVR7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G537380 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 9.9e-19 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = -3
BLAST of CU169810 vs. TrEMBL
Match: M5WHV6_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa009002mg PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.5e-08 Identity = 29/43 (67.44%), Postives = 35/43 (81.40%), Query Frame = -3
BLAST of CU169810 vs. TrEMBL
Match: A0A061E3T0_THECC (Myosin heavy chain-related, putative OS=Theobroma cacao GN=TCM_006069 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 4.6e-08 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -3
BLAST of CU169810 vs. TrEMBL
Match: W1PXG7_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00025p00209310 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 8.7e-07 Identity = 27/43 (62.79%), Postives = 34/43 (79.07%), Query Frame = -3
BLAST of CU169810 vs. TrEMBL
Match: A0A0K9QQ10_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_154520 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.9e-06 Identity = 26/39 (66.67%), Postives = 33/39 (84.62%), Query Frame = -3
BLAST of CU169810 vs. NCBI nr
Match: gi|659068507|ref|XP_008444778.1| (PREDICTED: probable kinetochore protein nuf2 [Cucumis melo]) HSP 1 Score: 97.8 bits (242), Expect = 7.1e-18 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = -3
BLAST of CU169810 vs. NCBI nr
Match: gi|449435874|ref|XP_004135719.1| (PREDICTED: paramyosin [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 7.1e-18 Identity = 47/48 (97.92%), Postives = 48/48 (100.00%), Query Frame = -3
BLAST of CU169810 vs. NCBI nr
Match: gi|720088692|ref|XP_010244538.1| (PREDICTED: uncharacterized protein LOC104588352 [Nelumbo nucifera]) HSP 1 Score: 63.5 bits (153), Expect = 1.5e-07 Identity = 30/40 (75.00%), Postives = 34/40 (85.00%), Query Frame = -3
BLAST of CU169810 vs. NCBI nr
Match: gi|657960174|ref|XP_008371655.1| (PREDICTED: centrosomal protein of 135 kDa [Malus domestica]) HSP 1 Score: 63.2 bits (152), Expect = 1.9e-07 Identity = 29/43 (67.44%), Postives = 36/43 (83.72%), Query Frame = -3
BLAST of CU169810 vs. NCBI nr
Match: gi|595863841|ref|XP_007211662.1| (hypothetical protein PRUPE_ppa009002mg [Prunus persica]) HSP 1 Score: 62.8 bits (151), Expect = 2.5e-07 Identity = 29/43 (67.44%), Postives = 35/43 (81.40%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|