CU169753 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGAGACATTTTCGTGAAATAGAGCACCCTTCAAGCCAAATATCTACGGATTTCAACAACATTTGGAACTCGCCGGAGGAAGAAGAAAAGATGGTGAATGCAAAGAGGGTGATACCCTTTTTGGAAGAAGCCACAGGGAGGAAGCAAATAATAATAATAACAATAATATCATAGAGAAGATGAGAGTTGAAAACAATATTA
BLAST of CU169753 vs. TrEMBL
Match: A0A0A0LSF6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G077140 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 9.9e-17 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = 2
BLAST of CU169753 vs. NCBI nr
Match: gi|778664946|ref|XP_011648446.1| (PREDICTED: CREB-regulated transcription coactivator 1-like [Cucumis sativus]) HSP 1 Score: 92.8 bits (229), Expect = 2.4e-16 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = 2
BLAST of CU169753 vs. NCBI nr
Match: gi|700209617|gb|KGN64713.1| (hypothetical protein Csa_1G077140 [Cucumis sativus]) HSP 1 Score: 92.8 bits (229), Expect = 2.4e-16 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = 2
BLAST of CU169753 vs. NCBI nr
Match: gi|659068150|ref|XP_008443003.1| (PREDICTED: uncharacterized protein DDB_G0271670-like [Cucumis melo]) HSP 1 Score: 84.7 bits (208), Expect = 6.6e-14 Identity = 39/44 (88.64%), Postives = 42/44 (95.45%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|