CU169718 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU169718
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	Histone H2B
Location	Chr6 : 21141648 .. 21141708 (+)
Sequence length	60

The following sequences are available for this feature:

AGGTCTTGAAGCAGGTTCATCCCGATATCGGAATCTCTAGCAAGGCCATGGGGATTATGA


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa6G448180	Csa6G448180	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0131892	H0131892	EST