CU168952 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CACCTCAGGCTCAGGATTGACAAGCCTGGCTTCAGAAGGATGCAGTACATTTTCCAAGAAAAAGAGAGATTCTGGAAAATCCATCAGCTCCAATTCGATTAACATTGTTCTCCATGCACCAGACTAATGCCTCAAGATCAAGATCCAATCCTACAGCAGTCCTACGTGAATCACTTCGAAGCCATTCTAGACTTAGAAGTGCAGTGCCAACAAAAATCTTCTTGGAAATGGATCGGTTC
BLAST of CU168952 vs. TrEMBL
Match: A0A0A0LSJ6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G145870 PE=4 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 1.7e-20 Identity = 52/54 (96.30%), Postives = 52/54 (96.30%), Query Frame = -2
BLAST of CU168952 vs. TrEMBL
Match: A0A0A0LSJ6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G145870 PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 2.0e+00 Identity = 19/26 (73.08%), Postives = 19/26 (73.08%), Query Frame = -3
HSP 2 Score: 99.0 bits (245), Expect = 2.8e-18 Identity = 47/54 (87.04%), Postives = 50/54 (92.59%), Query Frame = -2
BLAST of CU168952 vs. TrEMBL
Match: V4UDX5_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10028571mg PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 4.7e-18 Identity = 46/54 (85.19%), Postives = 50/54 (92.59%), Query Frame = -2
BLAST of CU168952 vs. TrEMBL
Match: A0A067F3J3_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g045407mg PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 4.7e-18 Identity = 46/54 (85.19%), Postives = 50/54 (92.59%), Query Frame = -2
BLAST of CU168952 vs. TrEMBL
Match: A0A061GZR1_THECC (S-adenosyl-L-methionine-dependent methyltransferases superfamily protein isoform 2 OS=Theobroma cacao GN=TCM_041447 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.4e-17 Identity = 44/54 (81.48%), Postives = 50/54 (92.59%), Query Frame = -2
BLAST of CU168952 vs. NCBI nr
Match: gi|449443392|ref|XP_004139461.1| (PREDICTED: uncharacterized protein LOC101220503 [Cucumis sativus]) HSP 1 Score: 108.2 bits (269), Expect = 6.5e-21 Identity = 52/54 (96.30%), Postives = 52/54 (96.30%), Query Frame = -2
BLAST of CU168952 vs. NCBI nr
Match: gi|659071831|ref|XP_008462130.1| (PREDICTED: uncharacterized protein LOC103500556 [Cucumis melo]) HSP 1 Score: 108.2 bits (269), Expect = 6.5e-21 Identity = 52/54 (96.30%), Postives = 52/54 (96.30%), Query Frame = -2
BLAST of CU168952 vs. NCBI nr
Match: gi|802600174|ref|XP_012072806.1| (PREDICTED: uncharacterized protein LOC105634551 [Jatropha curcas]) HSP 1 Score: 100.9 bits (250), Expect = 1.0e-18 Identity = 47/54 (87.04%), Postives = 50/54 (92.59%), Query Frame = -2
BLAST of CU168952 vs. NCBI nr
Match: gi|985462652|ref|XP_015388756.1| (PREDICTED: uncharacterized protein LOC102616334 isoform X2 [Citrus sinensis]) HSP 1 Score: 100.1 bits (248), Expect = 1.8e-18 Identity = 46/54 (85.19%), Postives = 50/54 (92.59%), Query Frame = -2
BLAST of CU168952 vs. NCBI nr
Match: gi|567863220|ref|XP_006424264.1| (hypothetical protein CICLE_v10028571mg [Citrus clementina]) HSP 1 Score: 100.1 bits (248), Expect = 1.8e-18 Identity = 46/54 (85.19%), Postives = 50/54 (92.59%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|