CU168339 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATGCTGCTTCCTTTTGGAGAAGAAAATTTCCTATCTTCGTATGAGTTAAAGCAGGCACAAGAGATTGCAACAAGAATGGTGCTTCAGTATGGCTGGAGACCAGATGATAGTCCAGCAATTTACAGCCGAAACAATGCAGTTTCTTTTTGAGTATGGGTGATAACTGTGAATAT
BLAST of CU168339 vs. Swiss-Prot
Match: FTSI5_ARATH (Probable inactive ATP-dependent zinc metalloprotease FTSHI 5, chloroplastic OS=Arabidopsis thaliana GN=FTSHI5 PE=2 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 5.6e-14 Identity = 37/48 (77.08%), Postives = 39/48 (81.25%), Query Frame = 1
BLAST of CU168339 vs. TrEMBL
Match: A0A0A0M0B7_CUCSA (Metalloprotease m41 ftsh OS=Cucumis sativus GN=Csa_1G673510 PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 1.7e-17 Identity = 45/47 (95.74%), Postives = 46/47 (97.87%), Query Frame = 1
BLAST of CU168339 vs. TrEMBL
Match: A0A059B763_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H04217 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.0e-14 Identity = 40/48 (83.33%), Postives = 44/48 (91.67%), Query Frame = 1
BLAST of CU168339 vs. TrEMBL
Match: A0A059B6H8_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H04217 PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 3.9e-14 Identity = 40/47 (85.11%), Postives = 43/47 (91.49%), Query Frame = 1
BLAST of CU168339 vs. TrEMBL
Match: W9RHH7_9ROSA (ATP-dependent zinc metalloprotease FtsH OS=Morus notabilis GN=L484_024479 PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 3.9e-14 Identity = 40/48 (83.33%), Postives = 43/48 (89.58%), Query Frame = 1
BLAST of CU168339 vs. TrEMBL
Match: A0A067JUT9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_23568 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 8.7e-14 Identity = 39/48 (81.25%), Postives = 44/48 (91.67%), Query Frame = 1
BLAST of CU168339 vs. NCBI nr
Match: gi|449449669|ref|XP_004142587.1| (PREDICTED: uncharacterized protein LOC101207174 [Cucumis sativus]) HSP 1 Score: 102.8 bits (255), Expect = 2.0e-19 Identity = 48/49 (97.96%), Postives = 48/49 (97.96%), Query Frame = 1
BLAST of CU168339 vs. NCBI nr
Match: gi|700211648|gb|KGN66744.1| (Metalloprotease m41 ftsh [Cucumis sativus]) HSP 1 Score: 98.2 bits (243), Expect = 4.9e-18 Identity = 45/47 (95.74%), Postives = 46/47 (97.87%), Query Frame = 1
BLAST of CU168339 vs. NCBI nr
Match: gi|659086122|ref|XP_008443775.1| (PREDICTED: uncharacterized protein LOC103487285 [Cucumis melo]) HSP 1 Score: 95.1 bits (235), Expect = 4.1e-17 Identity = 44/49 (89.80%), Postives = 45/49 (91.84%), Query Frame = 1
BLAST of CU168339 vs. NCBI nr
Match: gi|629095490|gb|KCW61485.1| (hypothetical protein EUGRSUZ_H04217 [Eucalyptus grandis]) HSP 1 Score: 87.4 bits (215), Expect = 8.6e-15 Identity = 40/48 (83.33%), Postives = 44/48 (91.67%), Query Frame = 1
BLAST of CU168339 vs. NCBI nr
Match: gi|702447608|ref|XP_010024934.1| (PREDICTED: uncharacterized protein LOC104415355 [Eucalyptus grandis]) HSP 1 Score: 87.4 bits (215), Expect = 8.6e-15 Identity = 40/48 (83.33%), Postives = 44/48 (91.67%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|