CU166788 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCCTTCAAGATGCAGTAGAGTATCGTAGCACTCGGCGTAGCTCACCTTCTCCAATGGAACAACGGTGCCTTGGTCTTATTCTTATACCCAACTCTTGCCGTGTATCCTGTCATGTGGATAGTACCATTGATGAACAATTGGCATTGCTATCAGTTTAGCAAATATAAGATGAAGCCTGAGATTAAGAAGAGATAGAAAAAAATGTGCACGCTTCTTTGATGGATTTGACTGTTTATATTGTTA
BLAST of CU166788 vs. TrEMBL
Match: A0A0A0LSZ5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025880 PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 6.7e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 3
BLAST of CU166788 vs. TrEMBL
Match: I3SG12_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 9.0e-17 Identity = 44/51 (86.27%), Postives = 49/51 (96.08%), Query Frame = 3
BLAST of CU166788 vs. TrEMBL
Match: A0A067G741_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g033666mg PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.5e-16 Identity = 44/53 (83.02%), Postives = 49/53 (92.45%), Query Frame = 3
BLAST of CU166788 vs. TrEMBL
Match: W9QV54_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_005333 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.5e-16 Identity = 43/51 (84.31%), Postives = 49/51 (96.08%), Query Frame = 3
BLAST of CU166788 vs. TrEMBL
Match: A0A059C635_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_E02425 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-16 Identity = 45/53 (84.91%), Postives = 49/53 (92.45%), Query Frame = 3
BLAST of CU166788 vs. NCBI nr
Match: gi|778656582|ref|XP_011649337.1| (PREDICTED: uncharacterized protein LOC101206200 [Cucumis sativus]) HSP 1 Score: 106.7 bits (265), Expect = 1.9e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 3
BLAST of CU166788 vs. NCBI nr
Match: gi|659068447|ref|XP_008444468.1| (PREDICTED: uncharacterized protein LOC103487784 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 1.9e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 3
BLAST of CU166788 vs. NCBI nr
Match: gi|388502276|gb|AFK39204.1| (unknown [Lotus japonicus]) HSP 1 Score: 96.3 bits (238), Expect = 2.6e-17 Identity = 44/51 (86.27%), Postives = 49/51 (96.08%), Query Frame = 3
BLAST of CU166788 vs. NCBI nr
Match: gi|703089800|ref|XP_010093906.1| (hypothetical protein L484_005333 [Morus notabilis]) HSP 1 Score: 95.5 bits (236), Expect = 4.4e-17 Identity = 43/51 (84.31%), Postives = 49/51 (96.08%), Query Frame = 3
BLAST of CU166788 vs. NCBI nr
Match: gi|568827362|ref|XP_006468032.1| (PREDICTED: uncharacterized protein LOC102616346 [Citrus sinensis]) HSP 1 Score: 95.5 bits (236), Expect = 4.4e-17 Identity = 44/53 (83.02%), Postives = 49/53 (92.45%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|