CU166622 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTAGTATGAGACTTTTATAAAGTCTACCATTGTCATATGGGGCCCTCCTTTGAGGTGATGTATTAACATCGACACAATTAATGTTTGTTTCTTTATTAATTAGAAGAAATTGATTCAAGAGGCTCAATTTGAGACTTTGTTGGGAAGAAAGTTCTTTCTTTTCTGTAAATTTCATGGGGAAGCTTTGTTGCTCTGATGATGATGGTGGTGGTGGATTGGATCTTATGGGACTCTTGGT
BLAST of CU166622 vs. TrEMBL
Match: A0A0A0K5W1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G393980 PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.4e-16 Identity = 45/46 (97.83%), Postives = 46/46 (100.00%), Query Frame = -3
BLAST of CU166622 vs. NCBI nr
Match: gi|700189645|gb|KGN44878.1| (hypothetical protein Csa_7G393980 [Cucumis sativus]) HSP 1 Score: 92.4 bits (228), Expect = 3.7e-16 Identity = 45/46 (97.83%), Postives = 46/46 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|