CU164870 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAAGGAGGTGGTTTTAGGCTTGGGCAAGGGGGGCAATCTTTTCTTTAATCTTTTTGTCATGACATTGAATCCAAGAGAGTTGGCTGCCGGTGTCTAGAACCAAGTCAGTGGGCTGTGGCGGCGTTCCGATCGGTAGAGAGACGACGAGGGCGGTGGAGGAGTATTTGAAAGGAAGCTTGAAGGAGCCGTAGGAGG
BLAST of CU164870 vs. TrEMBL
Match: A0A0A0L6V5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G188350 PE=3 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 2.6e-22 Identity = 51/56 (91.07%), Postives = 55/56 (98.21%), Query Frame = -3
BLAST of CU164870 vs. TrEMBL
Match: A0A0A0LBQ0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G188340 PE=3 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.1e-20 Identity = 48/56 (85.71%), Postives = 54/56 (96.43%), Query Frame = -3
BLAST of CU164870 vs. TrEMBL
Match: D7MID8_ARALL (Aspartyl protease family protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_493732 PE=3 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 2.2e-10 Identity = 35/52 (67.31%), Postives = 42/52 (80.77%), Query Frame = -3
BLAST of CU164870 vs. TrEMBL
Match: V4LXR6_EUTSA (Uncharacterized protein OS=Eutrema salsugineum GN=EUTSA_v10028350mg PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.1e-09 Identity = 35/49 (71.43%), Postives = 40/49 (81.63%), Query Frame = -3
BLAST of CU164870 vs. TrEMBL
Match: B9T2R1_RICCO (Aspartic proteinase nepenthesin-1, putative OS=Ricinus communis GN=RCOM_0593500 PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.1e-09 Identity = 33/52 (63.46%), Postives = 40/52 (76.92%), Query Frame = -3
BLAST of CU164870 vs. NCBI nr
Match: gi|778679913|ref|XP_004140731.2| (PREDICTED: aspartic proteinase PCS1-like [Cucumis sativus]) HSP 1 Score: 112.8 bits (281), Expect = 2.2e-22 Identity = 51/56 (91.07%), Postives = 55/56 (98.21%), Query Frame = -3
BLAST of CU164870 vs. NCBI nr
Match: gi|700202330|gb|KGN57463.1| (hypothetical protein Csa_3G188350 [Cucumis sativus]) HSP 1 Score: 112.8 bits (281), Expect = 2.2e-22 Identity = 51/56 (91.07%), Postives = 55/56 (98.21%), Query Frame = -3
BLAST of CU164870 vs. NCBI nr
Match: gi|778679910|ref|XP_011651212.1| (PREDICTED: aspartic proteinase PCS1-like [Cucumis sativus]) HSP 1 Score: 107.5 bits (267), Expect = 9.1e-21 Identity = 48/56 (85.71%), Postives = 54/56 (96.43%), Query Frame = -3
BLAST of CU164870 vs. NCBI nr
Match: gi|700202328|gb|KGN57461.1| (hypothetical protein Csa_3G188340 [Cucumis sativus]) HSP 1 Score: 107.5 bits (267), Expect = 9.1e-21 Identity = 48/56 (85.71%), Postives = 54/56 (96.43%), Query Frame = -3
BLAST of CU164870 vs. NCBI nr
Match: gi|659114575|ref|XP_008457122.1| (PREDICTED: aspartic proteinase PCS1 [Cucumis melo]) HSP 1 Score: 105.5 bits (262), Expect = 3.4e-20 Identity = 50/56 (89.29%), Postives = 54/56 (96.43%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|