CU164413 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCCATTGGCACGTCATTAATATCTGGTTTCTCATCTTGAAGCTCCCCCTTGGTTGCTACTGCACCACTTGGTTCAACATCATCTGATTCTAAAGCTTCATCTTCGACATTATCAGTGGCTTCATTTTCTGCAGCCTCTATTTTTTTGTTCCTCTAACACAGCAATCGGCATGTATTTAAATTTTCGGCGAGGAGGC
BLAST of CU164413 vs. TrEMBL
Match: A0A0A0LVV2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G195230 PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.4e-15 Identity = 44/49 (89.80%), Postives = 45/49 (91.84%), Query Frame = -3
BLAST of CU164413 vs. NCBI nr
Match: gi|700209983|gb|KGN65079.1| (hypothetical protein Csa_1G195230 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 4.8e-14 Identity = 44/49 (89.80%), Postives = 45/49 (91.84%), Query Frame = -3
BLAST of CU164413 vs. NCBI nr
Match: gi|449465421|ref|XP_004150426.1| (PREDICTED: uncharacterized protein LOC101221727 isoform X1 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 4.8e-14 Identity = 44/49 (89.80%), Postives = 45/49 (91.84%), Query Frame = -3
BLAST of CU164413 vs. NCBI nr
Match: gi|778659850|ref|XP_011655175.1| (PREDICTED: uncharacterized protein LOC101221727 isoform X2 [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 4.8e-14 Identity = 44/49 (89.80%), Postives = 45/49 (91.84%), Query Frame = -3
BLAST of CU164413 vs. NCBI nr
Match: gi|659118145|ref|XP_008458970.1| (PREDICTED: uncharacterized protein LOC103498224 isoform X2 [Cucumis melo]) HSP 1 Score: 77.0 bits (188), Expect = 1.3e-11 Identity = 39/49 (79.59%), Postives = 44/49 (89.80%), Query Frame = -3
BLAST of CU164413 vs. NCBI nr
Match: gi|659118143|ref|XP_008458968.1| (PREDICTED: uncharacterized protein LOC103498224 isoform X1 [Cucumis melo]) HSP 1 Score: 77.0 bits (188), Expect = 1.3e-11 Identity = 39/49 (79.59%), Postives = 44/49 (89.80%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|