CU163540 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATACACCAGTGGCAGTAGATTTTGAATGCAGCCAAGTTCTTCCATGTCAAGGCATAGTGTTACAAGACATTAACCTTACTTTCAATGGTGGTGGGAAGACAACTTCCATTTGTCATAATGTTAAGGGTTCTGCATCTGGTCAACAATTACCTCCCTCTTGCCTTTAATTACTTTGTGTTCTTTCTTTTCTTTTCTTCCTCACTACAGAGAG
BLAST of CU163540 vs. Swiss-Prot
Match: PGLR_ACTDE (Polygalacturonase OS=Actinidia deliciosa PE=2 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 3.1e-06 Identity = 21/44 (47.73%), Postives = 30/44 (68.18%), Query Frame = 1
BLAST of CU163540 vs. Swiss-Prot
Match: PGLR_OENOR (Exopolygalacturonase (Fragment) OS=Oenothera organensis PE=2 SV=1) HSP 1 Score: 50.4 bits (119), Expect = 9.0e-06 Identity = 23/49 (46.94%), Postives = 30/49 (61.22%), Query Frame = 1
BLAST of CU163540 vs. TrEMBL
Match: A0A0A0L660_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G063620 PE=3 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 3.4e-20 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 1
BLAST of CU163540 vs. TrEMBL
Match: A0A0A0L7H9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G063610 PE=3 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 4.3e-15 Identity = 40/49 (81.63%), Postives = 44/49 (89.80%), Query Frame = 1
BLAST of CU163540 vs. NCBI nr
Match: gi|700200929|gb|KGN56062.1| (hypothetical protein Csa_3G063620 [Cucumis sativus]) HSP 1 Score: 106.3 bits (264), Expect = 2.2e-20 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 1
BLAST of CU163540 vs. NCBI nr
Match: gi|449463753|ref|XP_004149596.1| (PREDICTED: exopolygalacturonase-like [Cucumis sativus]) HSP 1 Score: 106.3 bits (264), Expect = 2.2e-20 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 1
BLAST of CU163540 vs. NCBI nr
Match: gi|778688362|ref|XP_011652730.1| (PREDICTED: exopolygalacturonase-like [Cucumis sativus]) HSP 1 Score: 89.4 bits (220), Expect = 2.8e-15 Identity = 40/49 (81.63%), Postives = 44/49 (89.80%), Query Frame = 1
BLAST of CU163540 vs. NCBI nr
Match: gi|700200928|gb|KGN56061.1| (hypothetical protein Csa_3G063610 [Cucumis sativus]) HSP 1 Score: 89.4 bits (220), Expect = 2.8e-15 Identity = 40/49 (81.63%), Postives = 44/49 (89.80%), Query Frame = 1
BLAST of CU163540 vs. NCBI nr
Match: gi|659096624|ref|XP_008449197.1| (PREDICTED: exopolygalacturonase-like [Cucumis melo]) HSP 1 Score: 89.0 bits (219), Expect = 3.6e-15 Identity = 40/49 (81.63%), Postives = 43/49 (87.76%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|