CU162946 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATATGATAAGTTGTCTTTATTTTTCCTCTGAATTATTCTTACTTGATGTTGTTCTTGATAGAAACCAATTGAGGAATCAACTTTTGGCTCCACCTGTGAACTCTAACACACCTGCAACTCTATTGTTAGACACAATTATTTTCTTATTACAACATGAACTCCCATGGGTTTTGTAAAATTGTTGGTTACTTCCTGGAAAGAATGCATATGCGTTGATTAGGGATA
BLAST of CU162946 vs. TrEMBL
Match: A0A0A0KB45_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G000020 PE=4 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.1e-12 Identity = 42/54 (77.78%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU162946 vs. NCBI nr
Match: gi|778708897|ref|XP_011656310.1| (PREDICTED: LOW QUALITY PROTEIN: E3 ubiquitin-protein ligase UPL6 [Cucumis sativus]) HSP 1 Score: 84.3 bits (207), Expect = 9.5e-14 Identity = 43/56 (76.79%), Postives = 45/56 (80.36%), Query Frame = 3
BLAST of CU162946 vs. NCBI nr
Match: gi|700190398|gb|KGN45602.1| (hypothetical protein Csa_6G000020 [Cucumis sativus]) HSP 1 Score: 81.6 bits (200), Expect = 6.1e-13 Identity = 42/54 (77.78%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU162946 vs. NCBI nr
Match: gi|659116902|ref|XP_008458320.1| (PREDICTED: LOW QUALITY PROTEIN: E3 ubiquitin-protein ligase UPL6 [Cucumis melo]) HSP 1 Score: 78.2 bits (191), Expect = 6.8e-12 Identity = 39/56 (69.64%), Postives = 43/56 (76.79%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|