CU161987 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGATGTTGGGCCTCGCAAAATGTAAGTTTCCTTTTGTGGGTATTGAGAAGGTGTTGTTACTAGTGTGTCTGATGGTCTGTTTTTGTTTGTTTGTTTGTTTGGGTCTTACTACAGCAAGAGCATGCAGTTCACTACCTTTTCGGGAGCCGAAATTAGCAAATTGGCTGAAGTTCAGGTGTACAAAGGTTTATATTATGATACTACTCGGAAACCCATCGACGGCGGCTTGTTGGATCCACGAATGGTACGTATTATCATGGGGGATTGAAGGTTCATG
BLAST of CU161987 vs. TrEMBL
Match: A0A0A0LSG9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G084270 PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 2.0e-15 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 2
BLAST of CU161987 vs. TrEMBL
Match: W9REK1_9ROSA (DNA-directed RNA polymerase III subunit RPC1 OS=Morus notabilis GN=L484_007173 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.4e-08 Identity = 31/43 (72.09%), Postives = 36/43 (83.72%), Query Frame = 2
BLAST of CU161987 vs. TrEMBL
Match: I1LK95_SOYBN (DNA-directed RNA polymerase subunit OS=Glycine max GN=GLYMA_U034000 PE=3 SV=2) HSP 1 Score: 65.9 bits (159), Expect = 3.0e-08 Identity = 30/43 (69.77%), Postives = 38/43 (88.37%), Query Frame = 2
BLAST of CU161987 vs. TrEMBL
Match: A0A0B0MY34_GOSAR (DNA-directed RNA polymerase subunit OS=Gossypium arboreum GN=F383_02816 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 5.2e-08 Identity = 29/43 (67.44%), Postives = 37/43 (86.05%), Query Frame = 2
BLAST of CU161987 vs. TrEMBL
Match: A0A0D2QKE9_GOSRA (DNA-directed RNA polymerase subunit OS=Gossypium raimondii GN=B456_003G139100 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 5.2e-08 Identity = 29/43 (67.44%), Postives = 37/43 (86.05%), Query Frame = 2
BLAST of CU161987 vs. NCBI nr
Match: gi|700209632|gb|KGN64728.1| (hypothetical protein Csa_1G084270 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 5.7e-16 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 2
BLAST of CU161987 vs. NCBI nr
Match: gi|659130677|ref|XP_008465290.1| (PREDICTED: LOW QUALITY PROTEIN: DNA-directed RNA polymerase III subunit rpc1 [Cucumis melo]) HSP 1 Score: 92.0 bits (227), Expect = 5.7e-16 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 2
BLAST of CU161987 vs. NCBI nr
Match: gi|449462093|ref|XP_004148776.1| (PREDICTED: DNA-directed RNA polymerase III subunit rpc1 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 5.7e-16 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 2
BLAST of CU161987 vs. NCBI nr
Match: gi|1009115388|ref|XP_015874201.1| (PREDICTED: DNA-directed RNA polymerase III subunit 1 [Ziziphus jujuba]) HSP 1 Score: 77.0 bits (188), Expect = 1.9e-11 Identity = 38/54 (70.37%), Postives = 43/54 (79.63%), Query Frame = 2
BLAST of CU161987 vs. NCBI nr
Match: gi|702481064|ref|XP_010033188.1| (PREDICTED: LOW QUALITY PROTEIN: DNA-directed RNA polymerase III subunit rpc1 [Eucalyptus grandis]) HSP 1 Score: 70.5 bits (171), Expect = 1.8e-09 Identity = 30/43 (69.77%), Postives = 37/43 (86.05%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|