CU160843 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGTCAAGTAGTCATGGGCCACCACCGGAACAACAGCTTGTGAGGTTCAGAAGCCAGAGGATTCTGTCGTGCTTGACTGGCCATTAAAATTTGTAAGGGCTTATTCTTCCAAACTTAAGATTAATGGATGTGTACAGCATAATTATTAATCATCTTCAAACCATACTTGATGTTGATAACTACTTACAAAAGCTTCTGCTTTAATTCAAATTTTTGTGTCTTTTTTCG
BLAST of CU160843 vs. TrEMBL
Match: A0A0A0LL24_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G123040 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 3.6e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 1
BLAST of CU160843 vs. NCBI nr
Match: gi|449442349|ref|XP_004138944.1| (PREDICTED: uncharacterized protein LOC101210346 [Cucumis sativus]) HSP 1 Score: 63.5 bits (153), Expect = 1.8e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 1
BLAST of CU160843 vs. NCBI nr
Match: gi|659082088|ref|XP_008441665.1| (PREDICTED: uncharacterized protein LOC103485749 [Cucumis melo]) HSP 1 Score: 58.5 bits (140), Expect = 5.7e-06 Identity = 26/28 (92.86%), Postives = 26/28 (92.86%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|