CU160765 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTTGACGGAAGTGTTAGTCCTGTTGGTACTCCAAGTCCTGCTCCACGCCCCTGATCATGGTGGCGCGTCTGCTGCACCTTCCACTTCGGTGGTTGGCGGTGTTAATGAAACTGCTGCTGCGCCTACCCCCAAGGCGTCGGGTCTTGACAAAGCTGGCGTTCCCGGAATTCAGCGGCGGAATTTGGGGTTTGTTGTCCTGAGTTGGTTTTTGTTTGCTGGTTT
BLAST of CU160765 vs. TrEMBL
Match: A0A0A0K5A4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G368155 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.0e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 3
BLAST of CU160765 vs. NCBI nr
Match: gi|700189430|gb|KGN44663.1| (hypothetical protein Csa_7G368155 [Cucumis sativus]) HSP 1 Score: 112.8 bits (281), Expect = 2.5e-22 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 3
BLAST of CU160765 vs. NCBI nr
Match: gi|449463214|ref|XP_004149329.1| (PREDICTED: auxin-induced in root cultures protein 12-like [Cucumis sativus]) HSP 1 Score: 112.8 bits (281), Expect = 2.5e-22 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|