CU160033 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTGTTGATATGCATGCCGTTCACTTGAATATTACACATTTCACATCCTGGGACTGTTGTTCCTTTAGTTTGATTCATAGGGTCCGGATTTTTTGAGAAAGAGTAAATGCTCTCTTCCAATATTATTGATTGAAAACTCAATTTTCAAGCAGAGGTCGAGCCTCTTAAATATACAATCAATGAAAT
BLAST of CU160033 vs. TrEMBL
Match: A0A0A0KVN2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G099730 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 3.7e-10 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of CU160033 vs. NCBI nr
Match: gi|700198512|gb|KGN53670.1| (hypothetical protein Csa_4G099730 [Cucumis sativus]) HSP 1 Score: 71.6 bits (174), Expect = 5.3e-10 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|