CU158270 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCATCTCAGTTCCGCCGCTGCCGTTCTTCGGTTCGTGCTCGTACAGCATCCTATCTAACGGCTCTGCACTGATTGGTATTCTCCCAATCTCCATCTATCTCTGTCTCCTCACTCG
BLAST of CU158270 vs. TrEMBL
Match: A0A0A0KDN4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G366410 PE=4 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 4.0e-12 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 3
BLAST of CU158270 vs. NCBI nr
Match: gi|700192439|gb|KGN47643.1| (hypothetical protein Csa_6G366410 [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 4.9e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|