CU157746 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAATTGTAGAGTTCTTTACTTGCTTTACTTCCTCGTTGAGGCTGCTTAAAATGAGAAAAAGGATGTCTACCTTTCACAATGTGTCCGGCCAGGTGTCGATTATGACAAAAAGAATGTTTTTGGACAAACATCTAGCACAGATATTATATATCATTCCCGAAGCAGTGAATATTGATAAAGTGATGATTCACGACAAGAAGACATTG
BLAST of CU157746 vs. Swiss-Prot
Match: CDT1A_ARATH (CDT1-like protein a, chloroplastic OS=Arabidopsis thaliana GN=CDT1A PE=1 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.9e-09 Identity = 29/65 (44.62%), Postives = 41/65 (63.08%), Query Frame = 3
BLAST of CU157746 vs. TrEMBL
Match: A0A0A0LQM9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043230 PE=4 SV=1) HSP 1 Score: 136.3 bits (342), Expect = 1.3e-29 Identity = 68/68 (100.00%), Postives = 68/68 (100.00%), Query Frame = 3
BLAST of CU157746 vs. TrEMBL
Match: A0A0V0IHS0_SOLCH (Putative CDT1-like protein a, chloroplastic-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 3.0e-13 Identity = 38/66 (57.58%), Postives = 48/66 (72.73%), Query Frame = 3
BLAST of CU157746 vs. TrEMBL
Match: M1B861_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400015216 PE=4 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 6.7e-13 Identity = 38/66 (57.58%), Postives = 47/66 (71.21%), Query Frame = 3
BLAST of CU157746 vs. TrEMBL
Match: K4BEW8_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 6.7e-13 Identity = 38/66 (57.58%), Postives = 47/66 (71.21%), Query Frame = 3
BLAST of CU157746 vs. TrEMBL
Match: A0A166BN76_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_011408 PE=4 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 6.7e-13 Identity = 38/68 (55.88%), Postives = 51/68 (75.00%), Query Frame = 3
BLAST of CU157746 vs. NCBI nr
Match: gi|778657537|ref|XP_011651063.1| (PREDICTED: CDT1-like protein a, chloroplastic [Cucumis sativus]) HSP 1 Score: 133.7 bits (335), Expect = 1.3e-28 Identity = 68/68 (100.00%), Postives = 68/68 (100.00%), Query Frame = 3
BLAST of CU157746 vs. NCBI nr
Match: gi|659066989|ref|XP_008437096.1| (PREDICTED: CDT1-like protein a, chloroplastic isoform X1 [Cucumis melo]) HSP 1 Score: 123.6 bits (309), Expect = 1.3e-25 Identity = 61/67 (91.04%), Postives = 65/67 (97.01%), Query Frame = 3
BLAST of CU157746 vs. NCBI nr
Match: gi|659066993|ref|XP_008437112.1| (PREDICTED: CDT1-like protein a, chloroplastic isoform X2 [Cucumis melo]) HSP 1 Score: 104.4 bits (259), Expect = 8.1e-20 Identity = 51/56 (91.07%), Postives = 55/56 (98.21%), Query Frame = 3
BLAST of CU157746 vs. NCBI nr
Match: gi|719963177|ref|XP_010248885.1| (PREDICTED: CDT1-like protein a, chloroplastic isoform X1 [Nelumbo nucifera]) HSP 1 Score: 82.0 bits (201), Expect = 4.3e-13 Identity = 36/67 (53.73%), Postives = 51/67 (76.12%), Query Frame = 3
BLAST of CU157746 vs. NCBI nr
Match: gi|719963181|ref|XP_010248901.1| (PREDICTED: CDT1-like protein a, chloroplastic isoform X3 [Nelumbo nucifera]) HSP 1 Score: 82.0 bits (201), Expect = 4.3e-13 Identity = 36/67 (53.73%), Postives = 51/67 (76.12%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|