CU157180 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CACAAATTCTAATGTTCTTCTTAATCCTAATGGTTAATCCAGGAGGAGTTTTCAAGACTGCAAAATAGCTAATGCTAACTTCTCACTATGGTACTGTAGCTTTAATTCTCTGTCCTGCTGTTCATGAAGAAAAGCACATGGCTTGTGTCTGGCACATACCCAATCTCTTTAATTTTCCCACTTATTTTCTCCCACATCCTCTGT
BLAST of CU157180 vs. TrEMBL
Match: A0A0A0LSV8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G171070 PE=4 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.4e-07 Identity = 28/30 (93.33%), Postives = 29/30 (96.67%), Query Frame = -2
BLAST of CU157180 vs. TrEMBL
Match: A0A0A0LSV8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G171070 PE=4 SV=1) HSP 1 Score: 46.2 bits (108), Expect = 1.8e-02 Identity = 21/21 (100.00%), Postives = 21/21 (100.00%), Query Frame = -3
HSP 2 Score: 40.4 bits (93), Expect = 1.0e+00 Identity = 19/22 (86.36%), Postives = 19/22 (86.36%), Query Frame = -1
BLAST of CU157180 vs. NCBI nr
Match: gi|449443492|ref|XP_004139511.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g24000, mitochondrial-like [Cucumis sativus]) HSP 1 Score: 65.1 bits (157), Expect = 5.4e-08 Identity = 28/30 (93.33%), Postives = 29/30 (96.67%), Query Frame = -2
BLAST of CU157180 vs. NCBI nr
Match: gi|659128610|ref|XP_008464285.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g24000, mitochondrial isoform X2 [Cucumis melo]) HSP 1 Score: 63.2 bits (152), Expect = 2.0e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = -2
BLAST of CU157180 vs. NCBI nr
Match: gi|659128608|ref|XP_008464284.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g24000, mitochondrial isoform X1 [Cucumis melo]) HSP 1 Score: 63.2 bits (152), Expect = 2.0e-07 Identity = 27/30 (90.00%), Postives = 29/30 (96.67%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|