CU157137 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGTCCTGGTGAGGGGAAGCAAGGAAATTGGACCTGGAAAGAAATGGTGTAAACTTCACAGGCATAATGTCAGTAATTGGTAGTTTTAAAATAGACATTAGAATGCTTTGAATTTGCAGTTGGAAAAAGAAGTCAGCAAAGAATACTAAGAATTAGTCGCATTGCTTGAAAAACCACTTCAATTATTTCTGTCATTGATCTTTCTTCTCCCACTCCTTCCTGTAATCTTTCCTC
BLAST of CU157137 vs. TrEMBL
Match: A0A0A0KR26_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G292190 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.7e-09 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = -2
BLAST of CU157137 vs. TrEMBL
Match: A0A0A0KSY6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G292180 PE=4 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 2.8e-07 Identity = 31/33 (93.94%), Postives = 33/33 (100.00%), Query Frame = -1
BLAST of CU157137 vs. NCBI nr
Match: gi|778701968|ref|XP_011655117.1| (PREDICTED: pentatricopeptide repeat-containing protein At5g39680 [Cucumis sativus]) HSP 1 Score: 67.8 bits (164), Expect = 9.6e-09 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = -2
BLAST of CU157137 vs. NCBI nr
Match: gi|659113970|ref|XP_008456846.1| (PREDICTED: pentatricopeptide repeat-containing protein At5g39680 isoform X1 [Cucumis melo]) HSP 1 Score: 62.8 bits (151), Expect = 3.1e-07 Identity = 29/32 (90.62%), Postives = 31/32 (96.88%), Query Frame = -2
BLAST of CU157137 vs. NCBI nr
Match: gi|700195684|gb|KGN50861.1| (hypothetical protein Csa_5G292180 [Cucumis sativus]) HSP 1 Score: 60.1 bits (144), Expect = 2.0e-06 Identity = 31/33 (93.94%), Postives = 33/33 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|