CU156422 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTTTTCACATGTCCTGCATCGATACCTGGTTCCGATCTCACTCTTCCTGTCCTTCCTGTCGTCAGATTCTGGTGGTAAGTCAGTGCAGAGTGCGGTCGGTTTCCGGCGAGCTCG
BLAST of CU156422 vs. Swiss-Prot
Match: ATL8_ARATH (RING-H2 finger protein ATL8 OS=Arabidopsis thaliana GN=ATL8 PE=2 SV=2) HSP 1 Score: 60.1 bits (144), Expect = 6.2e-09 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 2
BLAST of CU156422 vs. Swiss-Prot
Match: ATL80_ARATH (RING-H2 finger protein ATL80 OS=Arabidopsis thaliana GN=ATL80 PE=2 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 1.4e-08 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 2
BLAST of CU156422 vs. TrEMBL
Match: A0A0A0L5Y2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G664340 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 8.7e-10 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of CU156422 vs. TrEMBL
Match: I1K799_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_06G015200 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 1.8e-07 Identity = 25/29 (86.21%), Postives = 27/29 (93.10%), Query Frame = 2
BLAST of CU156422 vs. TrEMBL
Match: A0A022Q8P8_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a014346mg PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 1.8e-07 Identity = 24/30 (80.00%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of CU156422 vs. TrEMBL
Match: C6TKF9_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_04G015200 PE=2 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 1.8e-07 Identity = 25/29 (86.21%), Postives = 27/29 (93.10%), Query Frame = 2
BLAST of CU156422 vs. TrEMBL
Match: G7J5Z4_MEDTR (Anaphase-promoting complex subunit 11 RING-H2 finger protein OS=Medicago truncatula GN=MTR_3g116000 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 2.4e-07 Identity = 25/29 (86.21%), Postives = 27/29 (93.10%), Query Frame = 2
BLAST of CU156422 vs. NCBI nr
Match: gi|449455635|ref|XP_004145558.1| (PREDICTED: RING-H2 finger protein ATL8 [Cucumis sativus]) HSP 1 Score: 69.7 bits (169), Expect = 1.2e-09 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of CU156422 vs. NCBI nr
Match: gi|659105085|ref|XP_008453009.1| (PREDICTED: RING-H2 finger protein ATL80 [Cucumis melo]) HSP 1 Score: 68.2 bits (165), Expect = 3.6e-09 Identity = 28/30 (93.33%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of CU156422 vs. NCBI nr
Match: gi|848911157|ref|XP_012854057.1| (PREDICTED: RING-H2 finger protein ATL8-like [Erythranthe guttata]) HSP 1 Score: 62.0 bits (149), Expect = 2.6e-07 Identity = 24/30 (80.00%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of CU156422 vs. NCBI nr
Match: gi|359806958|ref|NP_001241583.1| (uncharacterized protein LOC100794614 [Glycine max]) HSP 1 Score: 62.0 bits (149), Expect = 2.6e-07 Identity = 25/29 (86.21%), Postives = 27/29 (93.10%), Query Frame = 2
BLAST of CU156422 vs. NCBI nr
Match: gi|502130984|ref|XP_004500836.1| (PREDICTED: RING-H2 finger protein ATL80-like [Cicer arietinum]) HSP 1 Score: 62.0 bits (149), Expect = 2.6e-07 Identity = 25/29 (86.21%), Postives = 27/29 (93.10%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|