CU155680 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTGTCCAAAAAAAATGGCTTCTAAGATATCTCTCATTTGGCAACTGGTTGTGGTTTTAATGGCTATTTTAAGTTGTAGTGTTGCAGCAAGGCATCGGGTTTCTACACCTCAAACTGCTTACAAGGACGCAGTGGGAATCAAAAGCATAAAGAAGGTTTTTAAGCCCGTTCCAAAGAAAGATGAACCTAGGGGTGGAAATTACTAATCAAGTTGGAAAAATAATTAAATACATTGGAGGATGTTAAGTTTTCATAACATTTTTACTTCATAATAAATTATCTTTTCGGTCAAAATGACATGTAGTTCAATTCACATATCACTTGTCCTAAAAAAAAGTA
BLAST of CU155680 vs. TrEMBL
Match: A0A0A0KW87_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G022260 PE=4 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 4.0e-26 Identity = 62/63 (98.41%), Postives = 63/63 (100.00%), Query Frame = 1
BLAST of CU155680 vs. NCBI nr
Match: gi|700197981|gb|KGN53139.1| (hypothetical protein Csa_4G022260 [Cucumis sativus]) HSP 1 Score: 122.5 bits (306), Expect = 4.8e-25 Identity = 62/63 (98.41%), Postives = 63/63 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|