CU155442 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU155442
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr4 : 7802081 .. 7802134 (+)
Sequence length	54

The following sequences are available for this feature:

GAACCCAAAGTTAAGTTATGCTTACAATTTTGCCTATTTCGATTTTGCCTTCCT


Library category	ESTs
gynoecious flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa4G129010	Csa4G129010	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
G0213384	G0213384	EST