CU154727 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGCCAATGTTGGTCTAGTAAATGAACGTCAGTTCAACTTCATCCAGCTCAAAAGGGCTGTATATCAAATGCGTGAACTGAGCCCCTTCAAAAAAAGATGCCACTCATAATTTTGCATAAAAGCGCATCACTGACGGTCCTGCACGGAATCCTAATAATATGAAATTAATAGAGACATAGGAAAAATTGTGGTGCACTC
BLAST of CU154727 vs. TrEMBL
Match: A0A0A0M056_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G659060 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 4.0e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 3
BLAST of CU154727 vs. NCBI nr
Match: gi|700211588|gb|KGN66684.1| (hypothetical protein Csa_1G659060 [Cucumis sativus]) HSP 1 Score: 62.4 bits (150), Expect = 3.4e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 3
BLAST of CU154727 vs. NCBI nr
Match: gi|449449619|ref|XP_004142562.1| (PREDICTED: proteinaceous RNase P 1, chloroplastic/mitochondrial [Cucumis sativus]) HSP 1 Score: 62.4 bits (150), Expect = 3.4e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|