CU154187 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU154187
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr6 : 12755140 .. 12755189 (-)
Sequence length	54

The following sequences are available for this feature:

ACTAATCAAGGAATACAAGTAAGAAATATAAACTAAGCAAATAACAGAATTTAT


Library category	ESTs
gynoecious flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa6G199790	Csa6G199790	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
G0205091	G0205091	EST