CU152923 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCGAAATCTTCCATACTTATCTCTTAATCGGCATATGGAAAGATAATCCCACAAATTCAATATTTTGTTGCAACTGAACGTCATTCAAAGTGAATACCAGGCTACTTAAGTCAGCTTTAACAGAATATTGTGGAGTACTATTATCAAGCTTTCCTGACCTGTTAACCATGAGTGAACAAAACTGCATCACATGGAGCTAATATGAAGTCTACTTTTTCTCATGTGCTC
BLAST of CU152923 vs. NCBI nr
Match: gi|778664067|ref|XP_011660210.1| (PREDICTED: uncharacterized protein LOC101204937 isoform X2 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 7.6e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = -3
BLAST of CU152923 vs. NCBI nr
Match: gi|659085896|ref|XP_008443663.1| (PREDICTED: putative vacuolar protein sorting-associated protein 13A [Cucumis melo]) HSP 1 Score: 74.7 bits (182), Expect = 7.6e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = -3
BLAST of CU152923 vs. NCBI nr
Match: gi|778664064|ref|XP_011660209.1| (PREDICTED: uncharacterized protein LOC101204937 isoform X1 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 7.6e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|