CU152478 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GACACACCCTTTCCCAGAAAATGACCACCAATCTACTCATCTTTCGCCCTATCAGAATCCAACCATCTGCCACCTCTGGCTCCAGCTCCGGTCAACCGAAAACCTATATCCATACCCTGTCGCCACGGTTGGCCTCAATGGAGACTTGACCCACCAGACTACATCGGT
BLAST of CU152478 vs. TrEMBL
Match: A0A0A0LI01_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G006010 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.6e-07 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 1
BLAST of CU152478 vs. TrEMBL
Match: A0A0A0LI01_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G006010 PE=4 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 6.0e-04 Identity = 25/27 (92.59%), Postives = 25/27 (92.59%), Query Frame = 3
BLAST of CU152478 vs. NCBI nr
Match: gi|700205535|gb|KGN60654.1| (hypothetical protein Csa_2G006010 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.0e-07 Identity = 24/25 (96.00%), Postives = 25/25 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|