CU152170 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCAGATAGAACTTTCTCTTCATTTATTGTGGTTCGGCAAAGGAAGCTGAACCAATATCCCATGCACTTCAGGATTGGCATTAAGCTCGTGAACTTTGCTGATCAATTCAGCCTCAGACACTTGCTCAGGAAGATCAAATCTCAAAAGACTTGATCCCTACTTCCAGGCACGCCTTCCTCTTCATATTTACATAGGTAAGCGAATCTTTTCTATTCCCC
BLAST of CU152170 vs. Swiss-Prot
Match: FOLD2_ARATH (Bifunctional protein FolD 2 OS=Arabidopsis thaliana GN=FOLD2 PE=2 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 9.5e-11 Identity = 30/35 (85.71%), Postives = 32/35 (91.43%), Query Frame = -3
HSP 2 Score: 47.8 bits (112), Expect = 6.0e-05 Identity = 21/27 (77.78%), Postives = 22/27 (81.48%), Query Frame = -2
BLAST of CU152170 vs. Swiss-Prot
Match: FOLD_WOLWR (Bifunctional protein FolD OS=Wolbachia sp. subsp. Drosophila simulans (strain wRi) GN=folD PE=3 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 5.8e-08 Identity = 25/35 (71.43%), Postives = 28/35 (80.00%), Query Frame = -3
BLAST of CU152170 vs. Swiss-Prot
Match: FOLD_PARL1 (Bifunctional protein FolD OS=Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966) GN=folD PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.3e-07 Identity = 24/43 (55.81%), Postives = 30/43 (69.77%), Query Frame = -3
BLAST of CU152170 vs. Swiss-Prot
Match: FOLD_XANC5 (Bifunctional protein FolD OS=Xanthomonas campestris pv. vesicatoria (strain 85-10) GN=folD PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 2.9e-07 Identity = 26/47 (55.32%), Postives = 32/47 (68.09%), Query Frame = -3
BLAST of CU152170 vs. Swiss-Prot
Match: FOLD_XANAC (Bifunctional protein FolD OS=Xanthomonas axonopodis pv. citri (strain 306) GN=folD PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 2.9e-07 Identity = 26/47 (55.32%), Postives = 32/47 (68.09%), Query Frame = -3
BLAST of CU152170 vs. TrEMBL
Match: A0A0A0KWH1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G001540 PE=3 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 1.0e-11 Identity = 37/43 (86.05%), Postives = 37/43 (86.05%), Query Frame = -3
BLAST of CU152170 vs. TrEMBL
Match: A0A0A0KWH1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G001540 PE=3 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 6.4e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -2
HSP 2 Score: 72.8 bits (177), Expect = 1.9e-10 Identity = 35/43 (81.40%), Postives = 37/43 (86.05%), Query Frame = -3
BLAST of CU152170 vs. TrEMBL
Match: A0A0J8BES3_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_2g045600 PE=3 SV=1) HSP 1 Score: 46.6 bits (109), Expect = 1.5e-02 Identity = 21/27 (77.78%), Postives = 23/27 (85.19%), Query Frame = -2
HSP 2 Score: 72.4 bits (176), Expect = 2.5e-10 Identity = 33/36 (91.67%), Postives = 35/36 (97.22%), Query Frame = -3
BLAST of CU152170 vs. TrEMBL
Match: A0A067K8J8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_13900 PE=3 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 2.5e-02 Identity = 20/27 (74.07%), Postives = 25/27 (92.59%), Query Frame = -2
HSP 2 Score: 72.0 bits (175), Expect = 3.3e-10 Identity = 32/36 (88.89%), Postives = 35/36 (97.22%), Query Frame = -3
BLAST of CU152170 vs. TrEMBL
Match: A9PIC3_POPTR (Putative uncharacterized protein OS=Populus trichocarpa PE=2 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 2.5e-02 Identity = 20/27 (74.07%), Postives = 24/27 (88.89%), Query Frame = -2
HSP 2 Score: 72.0 bits (175), Expect = 3.3e-10 Identity = 32/36 (88.89%), Postives = 35/36 (97.22%), Query Frame = -3
BLAST of CU152170 vs. NCBI nr
Match: gi|449469104|ref|XP_004152261.1| (PREDICTED: bifunctional protein FolD 2 isoform X1 [Cucumis sativus]) HSP 1 Score: 79.0 bits (193), Expect = 3.9e-12 Identity = 37/43 (86.05%), Postives = 37/43 (86.05%), Query Frame = -3
BLAST of CU152170 vs. NCBI nr
Match: gi|778689243|ref|XP_011652923.1| (PREDICTED: bifunctional protein FolD 2 isoform X2 [Cucumis sativus]) HSP 1 Score: 79.0 bits (193), Expect = 3.9e-12 Identity = 37/43 (86.05%), Postives = 37/43 (86.05%), Query Frame = -3
BLAST of CU152170 vs. NCBI nr
Match: gi|700197629|gb|KGN52787.1| (hypothetical protein Csa_4G001540 [Cucumis sativus]) HSP 1 Score: 79.0 bits (193), Expect = 3.9e-12 Identity = 37/43 (86.05%), Postives = 37/43 (86.05%), Query Frame = -3
BLAST of CU152170 vs. NCBI nr
Match: gi|659108752|ref|XP_008454370.1| (PREDICTED: bifunctional protein FolD 2 isoform X2 [Cucumis melo]) HSP 1 Score: 79.0 bits (193), Expect = 3.9e-12 Identity = 37/43 (86.05%), Postives = 37/43 (86.05%), Query Frame = -3
BLAST of CU152170 vs. NCBI nr
Match: gi|659108749|ref|XP_008454369.1| (PREDICTED: bifunctional protein FolD 2 isoform X1 [Cucumis melo]) HSP 1 Score: 79.0 bits (193), Expect = 3.9e-12 Identity = 37/43 (86.05%), Postives = 37/43 (86.05%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|