CU151849 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCCCCGATCTCCCCAAACTCTTCCAGGAAAATTACGACCAATTGAACAAAAGTATTTTGATGATAATGATCACTCATGGACTGCTTTTGACATTGAAGATGTGCAGTGCTCTTGATACTGCTACCAAGTTGGTTGAATCAACCAACTCGAATTCAAGTATTTTTTGTTGGAGAAGATTTGTTGAGCTTGAACA
BLAST of CU151849 vs. TrEMBL
Match: A0A0A0K969_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G040570 PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 4.5e-11 Identity = 44/63 (69.84%), Postives = 46/63 (73.02%), Query Frame = 3
BLAST of CU151849 vs. TrEMBL
Match: M5XZZ2_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013050mg PE=4 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 4.3e-06 Identity = 31/49 (63.27%), Postives = 38/49 (77.55%), Query Frame = 3
BLAST of CU151849 vs. TrEMBL
Match: V4T2M5_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10002759mg PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 7.4e-06 Identity = 34/63 (53.97%), Postives = 44/63 (69.84%), Query Frame = 3
BLAST of CU151849 vs. TrEMBL
Match: A0A067GLZ3_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g031692mg PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 7.4e-06 Identity = 34/63 (53.97%), Postives = 44/63 (69.84%), Query Frame = 3
BLAST of CU151849 vs. NCBI nr
Match: gi|449446209|ref|XP_004140864.1| (PREDICTED: uncharacterized protein LOC101219718 [Cucumis sativus]) HSP 1 Score: 73.2 bits (178), Expect = 1.9e-10 Identity = 44/63 (69.84%), Postives = 46/63 (73.02%), Query Frame = 3
BLAST of CU151849 vs. NCBI nr
Match: gi|659088990|ref|XP_008445269.1| (PREDICTED: uncharacterized protein LOC103488352 [Cucumis melo]) HSP 1 Score: 71.6 bits (174), Expect = 5.4e-10 Identity = 43/63 (68.25%), Postives = 46/63 (73.02%), Query Frame = 3
BLAST of CU151849 vs. NCBI nr
Match: gi|659089750|ref|XP_008445672.1| (PREDICTED: uncharacterized protein LOC103488633 isoform X1 [Cucumis melo]) HSP 1 Score: 71.6 bits (174), Expect = 5.4e-10 Identity = 43/63 (68.25%), Postives = 46/63 (73.02%), Query Frame = 3
BLAST of CU151849 vs. NCBI nr
Match: gi|659089752|ref|XP_008445673.1| (PREDICTED: uncharacterized protein LOC103488633 isoform X2 [Cucumis melo]) HSP 1 Score: 71.6 bits (174), Expect = 5.4e-10 Identity = 43/63 (68.25%), Postives = 46/63 (73.02%), Query Frame = 3
BLAST of CU151849 vs. NCBI nr
Match: gi|659089754|ref|XP_008445675.1| (PREDICTED: uncharacterized protein LOC103488633 isoform X3 [Cucumis melo]) HSP 1 Score: 71.6 bits (174), Expect = 5.4e-10 Identity = 43/63 (68.25%), Postives = 46/63 (73.02%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|