CU151098 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGAACCAGACGATGAACCAAGATCGCAGGAATCCAGCCACTATATAGTCCATATCGCAGCTATTATTCCCTACTTGATCATATGCAAAATATCCACATGAGAAGCACAAAGCTGCAAAAGCCCACGGCCATGTTCCTCCAAACAATTGTGAATGCTCAAACATCCCCTCTGAACCGGACCATAACTCAGCCACCGGTTCACCATAAC
BLAST of CU151098 vs. TrEMBL
Match: A0A0A0KH54_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G385110 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.0e-13 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -3
BLAST of CU151098 vs. TrEMBL
Match: A0A0A0KH54_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G385110 PE=4 SV=1) HSP 1 Score: 42.0 bits (97), Expect = 3.5e-01 Identity = 18/19 (94.74%), Postives = 18/19 (94.74%), Query Frame = -2
HSP 2 Score: 79.0 bits (193), Expect = 2.6e-12 Identity = 33/37 (89.19%), Postives = 34/37 (91.89%), Query Frame = -3
BLAST of CU151098 vs. TrEMBL
Match: W9RNY8_9ROSA (TLC domain-containing protein 2 OS=Morus notabilis GN=L484_025464 PE=4 SV=1) HSP 1 Score: 33.1 bits (74), Expect = 1.6e+02 Identity = 14/19 (73.68%), Postives = 17/19 (89.47%), Query Frame = -2
HSP 2 Score: 76.6 bits (187), Expect = 1.3e-11 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = -3
BLAST of CU151098 vs. TrEMBL
Match: M5Y9B4_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa009773mg PE=4 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 8.6e+00 Identity = 14/19 (73.68%), Postives = 17/19 (89.47%), Query Frame = -2
HSP 2 Score: 75.1 bits (183), Expect = 3.7e-11 Identity = 31/38 (81.58%), Postives = 35/38 (92.11%), Query Frame = -3
BLAST of CU151098 vs. TrEMBL
Match: B9GU36_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0002s08390g PE=4 SV=2) HSP 1 Score: 72.0 bits (175), Expect = 3.1e-10 Identity = 30/38 (78.95%), Postives = 32/38 (84.21%), Query Frame = -3
BLAST of CU151098 vs. NCBI nr
Match: gi|449465449|ref|XP_004150440.1| (PREDICTED: TLC domain-containing protein 2 [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 2.5e-13 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -3
BLAST of CU151098 vs. NCBI nr
Match: gi|659133401|ref|XP_008466713.1| (PREDICTED: TLC domain-containing protein 2 [Cucumis melo]) HSP 1 Score: 79.3 bits (194), Expect = 2.8e-12 Identity = 33/35 (94.29%), Postives = 34/35 (97.14%), Query Frame = -3
BLAST of CU151098 vs. NCBI nr
Match: gi|703129974|ref|XP_010104494.1| (TLC domain-containing protein 2 [Morus notabilis]) HSP 1 Score: 78.2 bits (191), Expect = 6.2e-12 Identity = 33/37 (89.19%), Postives = 34/37 (91.89%), Query Frame = -3
BLAST of CU151098 vs. NCBI nr
Match: gi|645225568|ref|XP_008219636.1| (PREDICTED: TLC domain-containing protein 2 [Prunus mume]) HSP 1 Score: 75.9 bits (185), Expect = 3.1e-11 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = -3
BLAST of CU151098 vs. NCBI nr
Match: gi|596298253|ref|XP_007227461.1| (hypothetical protein PRUPE_ppa009773mg [Prunus persica]) HSP 1 Score: 75.9 bits (185), Expect = 3.1e-11 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|