CU150513 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTCCTTCTCAATTAACACTCCTCTCTTTTCTTCAAAACCATAGCTCCAAGCTGAGTTTTATCAAATCTGAATGAGCTACAACAGTGCTTATGAAACTGGAAAAACCCTTTTGAGAGGG
BLAST of CU150513 vs. TrEMBL
Match: A0A0A0L338_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G119480 PE=4 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 1.7e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU150513 vs. NCBI nr
Match: gi|778676857|ref|XP_004133807.2| (PREDICTED: uncharacterized protein At4g00950 isoform X2 [Cucumis sativus]) HSP 1 Score: 65.5 bits (158), Expect = 2.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU150513 vs. NCBI nr
Match: gi|778676854|ref|XP_011650674.1| (PREDICTED: uncharacterized protein At4g00950 isoform X1 [Cucumis sativus]) HSP 1 Score: 65.5 bits (158), Expect = 2.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU150513 vs. NCBI nr
Match: gi|778676860|ref|XP_011650675.1| (PREDICTED: uncharacterized protein At4g00950 isoform X3 [Cucumis sativus]) HSP 1 Score: 65.5 bits (158), Expect = 2.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU150513 vs. NCBI nr
Match: gi|778676863|ref|XP_011650676.1| (PREDICTED: uncharacterized protein At4g00950 isoform X4 [Cucumis sativus]) HSP 1 Score: 65.5 bits (158), Expect = 2.4e-08 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|