CU150290 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATCGTCTTTTCTCCCATCCCATGCACGGTCTATAACCGTTCATCATGGAACTCCAAGCTGCCAAGTCTCTATGTATCATACTATTAAAAACTTTTTCTGCCTTCTCAATACTTCCAAATTTGCAATACAAATGTATCAACGATGTTGAAACTTGACTATCCGATGCTAAACCGTCCTGCTGTATGAATGCCTCAA
BLAST of CU150290 vs. Swiss-Prot
Match: PP127_ARATH (Putative pentatricopeptide repeat-containing protein At1g77010, mitochondrial OS=Arabidopsis thaliana GN=PCMP-E5 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 7.4e-07 Identity = 24/47 (51.06%), Postives = 31/47 (65.96%), Query Frame = -3
HSP 2 Score: 31.6 bits (70), Expect = 4.0e+00 Identity = 14/46 (30.43%), Postives = 25/46 (54.35%), Query Frame = -3
HSP 3 Score: 31.2 bits (69), Expect = 5.2e+00 Identity = 17/50 (34.00%), Postives = 26/50 (52.00%), Query Frame = -3
BLAST of CU150290 vs. Swiss-Prot
Match: PP219_ARATH (Putative pentatricopeptide repeat-containing protein At3g08820 OS=Arabidopsis thaliana GN=PCMP-H84 PE=3 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.3e-06 Identity = 21/52 (40.38%), Postives = 35/52 (67.31%), Query Frame = -3
BLAST of CU150290 vs. Swiss-Prot
Match: PP175_ARATH (Pentatricopeptide repeat-containing protein At2g29760, chloroplastic OS=Arabidopsis thaliana GN=PCMP-H33 PE=2 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 2.8e-06 Identity = 21/52 (40.38%), Postives = 36/52 (69.23%), Query Frame = -3
HSP 2 Score: 45.1 bits (105), Expect = 3.5e-04 Identity = 19/49 (38.78%), Postives = 30/49 (61.22%), Query Frame = -3
HSP 3 Score: 43.1 bits (100), Expect = 1.3e-03 Identity = 17/63 (26.98%), Postives = 40/63 (63.49%), Query Frame = -3
BLAST of CU150290 vs. Swiss-Prot
Match: PPR21_ARATH (Pentatricopeptide repeat-containing protein At1g08070, chloroplastic OS=Arabidopsis thaliana GN=PCMP-H12 PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 4.8e-06 Identity = 21/47 (44.68%), Postives = 33/47 (70.21%), Query Frame = -3
HSP 2 Score: 42.0 bits (97), Expect = 2.9e-03 Identity = 19/47 (40.43%), Postives = 29/47 (61.70%), Query Frame = -3
HSP 3 Score: 39.7 bits (91), Expect = 1.5e-02 Identity = 16/52 (30.77%), Postives = 30/52 (57.69%), Query Frame = -3
BLAST of CU150290 vs. Swiss-Prot
Match: PPR85_ARATH (Pentatricopeptide repeat-containing protein At1g59720, chloroplastic/mitochondrial OS=Arabidopsis thaliana GN=PCMP-H51 PE=2 SV=2) HSP 1 Score: 50.8 bits (120), Expect = 6.3e-06 Identity = 23/46 (50.00%), Postives = 30/46 (65.22%), Query Frame = -3
HSP 2 Score: 43.1 bits (100), Expect = 1.3e-03 Identity = 20/49 (40.82%), Postives = 27/49 (55.10%), Query Frame = -3
BLAST of CU150290 vs. TrEMBL
Match: A0A0A0LT91_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043310 PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 3.3e-22 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -3
BLAST of CU150290 vs. TrEMBL
Match: A0A0A0LT91_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043310 PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 1.6e+00 Identity = 17/47 (36.17%), Postives = 28/47 (59.57%), Query Frame = -3
HSP 2 Score: 77.0 bits (188), Expect = 9.1e-12 Identity = 33/54 (61.11%), Postives = 45/54 (83.33%), Query Frame = -3
BLAST of CU150290 vs. TrEMBL
Match: A0A0D2RDY6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G014400 PE=4 SV=1) HSP 1 Score: 43.1 bits (100), Expect = 1.5e-01 Identity = 19/56 (33.93%), Postives = 31/56 (55.36%), Query Frame = -3
HSP 2 Score: 38.1 bits (87), Expect = 4.7e+00 Identity = 12/40 (30.00%), Postives = 29/40 (72.50%), Query Frame = -3
HSP 3 Score: 76.3 bits (186), Expect = 1.6e-11 Identity = 33/54 (61.11%), Postives = 45/54 (83.33%), Query Frame = -3
BLAST of CU150290 vs. TrEMBL
Match: A0A061F704_THECC (Pentatricopeptide repeat superfamily protein, putative OS=Theobroma cacao GN=TCM_031344 PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 1.6e+00 Identity = 16/46 (34.78%), Postives = 30/46 (65.22%), Query Frame = -3
HSP 2 Score: 68.2 bits (165), Expect = 4.2e-09 Identity = 31/54 (57.41%), Postives = 41/54 (75.93%), Query Frame = -3
BLAST of CU150290 vs. TrEMBL
Match: B9SI50_RICCO (Pentatricopeptide repeat-containing protein, putative OS=Ricinus communis GN=RCOM_0612730 PE=4 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 8.0e+00 Identity = 13/44 (29.55%), Postives = 29/44 (65.91%), Query Frame = -3
HSP 2 Score: 32.0 bits (71), Expect = 3.4e+02 Identity = 13/40 (32.50%), Postives = 24/40 (60.00%), Query Frame = -3
HSP 3 Score: 64.3 bits (155), Expect = 6.1e-08 Identity = 28/47 (59.57%), Postives = 38/47 (80.85%), Query Frame = -3
BLAST of CU150290 vs. NCBI nr
Match: gi|449439735|ref|XP_004137641.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g12770 [Cucumis sativus]) HSP 1 Score: 112.1 bits (279), Expect = 3.7e-22 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = -3
BLAST of CU150290 vs. NCBI nr
Match: gi|659068757|ref|XP_008446053.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g29760, chloroplastic-like [Cucumis melo]) HSP 1 Score: 106.3 bits (264), Expect = 2.0e-20 Identity = 51/54 (94.44%), Postives = 52/54 (96.30%), Query Frame = -3
BLAST of CU150290 vs. NCBI nr
Match: gi|823163162|ref|XP_012481514.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g26782, mitochondrial-like isoform X3 [Gossypium raimondii]) HSP 1 Score: 77.4 bits (189), Expect = 1.0e-11 Identity = 33/54 (61.11%), Postives = 45/54 (83.33%), Query Frame = -3
BLAST of CU150290 vs. NCBI nr
Match: gi|823163158|ref|XP_012481512.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g21065-like isoform X1 [Gossypium raimondii]) HSP 1 Score: 77.4 bits (189), Expect = 1.0e-11 Identity = 33/54 (61.11%), Postives = 45/54 (83.33%), Query Frame = -3
BLAST of CU150290 vs. NCBI nr
Match: gi|823163160|ref|XP_012481513.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g26782, mitochondrial-like isoform X2 [Gossypium raimondii]) HSP 1 Score: 77.4 bits (189), Expect = 1.0e-11 Identity = 33/54 (61.11%), Postives = 45/54 (83.33%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|