CU148730 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTATACAGGGGATAAGAAATTGTCGTCTCGGAAAACTAAAAGAGCAGACTCTTCAGCCACAAAATCCAGAAAACGGAAGGGCAGGTCAGATAACACGGCATCACATTCAAAAGACAGGGAGGGATCAACCAAGGCCTCCTGCCAAGTCACCTAAAGTTATGAAATGCAAA
BLAST of CU148730 vs. TrEMBL
Match: A0A0A0L6Y1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G199010 PE=4 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 2.3e-14 Identity = 45/57 (78.95%), Postives = 47/57 (82.46%), Query Frame = 1
BLAST of CU148730 vs. NCBI nr
Match: gi|778679986|ref|XP_011651230.1| (PREDICTED: homeobox protein HOX1A [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 45/57 (78.95%), Postives = 47/57 (82.46%), Query Frame = 1
BLAST of CU148730 vs. NCBI nr
Match: gi|700202355|gb|KGN57488.1| (hypothetical protein Csa_3G199010 [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 1.3e-10 Identity = 45/57 (78.95%), Postives = 47/57 (82.46%), Query Frame = 1
BLAST of CU148730 vs. NCBI nr
Match: gi|659112354|ref|XP_008456180.1| (PREDICTED: homeobox protein HAT3.1 isoform X2 [Cucumis melo]) HSP 1 Score: 64.7 bits (156), Expect = 6.0e-08 Identity = 37/45 (82.22%), Postives = 42/45 (93.33%), Query Frame = 1
BLAST of CU148730 vs. NCBI nr
Match: gi|659112348|ref|XP_008456177.1| (PREDICTED: pathogenesis-related homeodomain protein isoform X1 [Cucumis melo]) HSP 1 Score: 64.7 bits (156), Expect = 6.0e-08 Identity = 37/45 (82.22%), Postives = 42/45 (93.33%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|