CU146054 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TAGTTGGTCCTATTTATACATATATCTACTTCTGTGATGAATGCCATAGACAGATATTTACTACCCTCTTCGGATCCCCAGAAGGTCAACTAAACATTTCCCCGTTCCGTGGATCAATCTTCCTTGGATCGTGACACAGAAGATCTCAAAGTTTAAACCATCAATGATTCTGCCACAGAAGTAAAAAGATAGGTGTTGTAGC
BLAST of CU146054 vs. TrEMBL
Match: A0A0A0KFW4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G290830 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 5.7e-09 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU146054 vs. TrEMBL
Match: A0A0A0KFW4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G290830 PE=4 SV=1) HSP 1 Score: 49.7 bits (117), Expect = 1.6e-03 Identity = 25/26 (96.15%), Postives = 25/26 (96.15%), Query Frame = 1
HSP 2 Score: 58.9 bits (141), Expect = 2.7e-06 Identity = 23/29 (79.31%), Postives = 27/29 (93.10%), Query Frame = 3
BLAST of CU146054 vs. TrEMBL
Match: A0A067GCA6_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g010701mg PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 2.7e-06 Identity = 23/29 (79.31%), Postives = 27/29 (93.10%), Query Frame = 3
BLAST of CU146054 vs. TrEMBL
Match: M5W4M2_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa005247mg PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.5e-06 Identity = 23/29 (79.31%), Postives = 28/29 (96.55%), Query Frame = 3
BLAST of CU146054 vs. TrEMBL
Match: G7JRG3_MEDTR (Alpha/beta fold hydrolase OS=Medicago truncatula GN=MTR_4g060900 PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 7.7e-06 Identity = 22/28 (78.57%), Postives = 27/28 (96.43%), Query Frame = 3
BLAST of CU146054 vs. NCBI nr
Match: gi|449463665|ref|XP_004149552.1| (PREDICTED: uncharacterized protein LOC101214346 [Cucumis sativus]) HSP 1 Score: 68.9 bits (167), Expect = 3.7e-09 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU146054 vs. NCBI nr
Match: gi|659127835|ref|XP_008463913.1| (PREDICTED: uncharacterized protein LOC103501926 [Cucumis melo]) HSP 1 Score: 66.6 bits (161), Expect = 1.8e-08 Identity = 27/29 (93.10%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU146054 vs. NCBI nr
Match: gi|502145260|ref|XP_004505955.1| (PREDICTED: uncharacterized protein LOC101501619 isoform X1 [Cicer arietinum]) HSP 1 Score: 60.8 bits (146), Expect = 1.0e-06 Identity = 24/29 (82.76%), Postives = 28/29 (96.55%), Query Frame = 3
BLAST of CU146054 vs. NCBI nr
Match: gi|1021488790|ref|XP_016187383.1| (PREDICTED: uncharacterized protein LOC107629180 [Arachis ipaensis]) HSP 1 Score: 60.5 bits (145), Expect = 1.3e-06 Identity = 24/29 (82.76%), Postives = 27/29 (93.10%), Query Frame = 3
BLAST of CU146054 vs. NCBI nr
Match: gi|641854329|gb|KDO73137.1| (hypothetical protein CISIN_1g010701mg [Citrus sinensis]) HSP 1 Score: 60.1 bits (144), Expect = 1.7e-06 Identity = 23/29 (79.31%), Postives = 27/29 (93.10%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|