CU145157 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU145157
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr3 : 15218859 .. 15218950 (+)
Sequence length	90

The following sequences are available for this feature:

ACATTTCGTAGCCTTTTTTCCTTTTATGAACGGATTATCTTCTCACAATTTCTTTGCAATGTGTTTTGCATTGCAACTTTTTCCCTGTGC


Library category	ESTs
gynoecious flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa3G236050	Csa3G236050	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
G0126001	G0126001	EST