CU144824 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AACAAGCCATTCGAAATGCTTCAAATTCCGGTGTTGCTCAAGAAACTATACGAAACACTGTTCGTAGAGCAAGCAAAAGTGATGACAGAGCAAGAAGCCAGGCAGATTCTTGGCGTCACAGAAGAAATGCCTTGGGAGGAAATTGTGAAGAAATATGATGCTATGTTTGAAAGGAATGCTCAAACTGGAAGCTTTTTATCTTCAGTCAAAAGTCCATAGAGACCAAA
BLAST of CU144824 vs. TrEMBL
Match: A0A0A0LSD2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G011490 PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.5e-13 Identity = 39/41 (95.12%), Postives = 41/41 (100.00%), Query Frame = 1
BLAST of CU144824 vs. TrEMBL
Match: A0A0A0LSD2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G011490 PE=4 SV=1) HSP 1 Score: 41.2 bits (95), Expect = 6.5e-01 Identity = 20/20 (100.00%), Postives = 20/20 (100.00%), Query Frame = 3
HSP 2 Score: 79.0 bits (193), Expect = 2.8e-12 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 1
BLAST of CU144824 vs. TrEMBL
Match: A0A151R2T5_CAJCA (Uncharacterized protein OS=Cajanus cajan GN=KK1_041973 PE=4 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.2e-10 Identity = 33/41 (80.49%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of CU144824 vs. TrEMBL
Match: A0A067LED2_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_23812 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.0e-10 Identity = 34/41 (82.93%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of CU144824 vs. TrEMBL
Match: A0A067LED2_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_23812 PE=4 SV=1) HSP 1 Score: 33.9 bits (76), Expect = 1.0e+02 Identity = 15/20 (75.00%), Postives = 18/20 (90.00%), Query Frame = 3
HSP 2 Score: 72.8 bits (177), Expect = 2.0e-10 Identity = 33/41 (80.49%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of CU144824 vs. NCBI nr
Match: gi|778656004|ref|XP_011660201.1| (PREDICTED: mitochondrial import inner membrane translocase subunit tim16-like [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 2.8e-13 Identity = 39/41 (95.12%), Postives = 41/41 (100.00%), Query Frame = 1
BLAST of CU144824 vs. NCBI nr
Match: gi|659106011|ref|XP_008453228.1| (PREDICTED: mitochondrial import inner membrane translocase subunit Tim16-like isoform X2 [Cucumis melo]) HSP 1 Score: 81.6 bits (200), Expect = 6.2e-13 Identity = 38/41 (92.68%), Postives = 41/41 (100.00%), Query Frame = 1
BLAST of CU144824 vs. NCBI nr
Match: gi|659106003|ref|XP_008453226.1| (PREDICTED: mitochondrial import inner membrane translocase subunit tim16-like isoform X1 [Cucumis melo]) HSP 1 Score: 81.6 bits (200), Expect = 6.2e-13 Identity = 38/41 (92.68%), Postives = 41/41 (100.00%), Query Frame = 1
BLAST of CU144824 vs. NCBI nr
Match: gi|659127284|ref|XP_008463624.1| (PREDICTED: mitochondrial import inner membrane translocase subunit tim16 [Cucumis melo]) HSP 1 Score: 80.1 bits (196), Expect = 1.8e-12 Identity = 37/41 (90.24%), Postives = 40/41 (97.56%), Query Frame = 1
BLAST of CU144824 vs. NCBI nr
Match: gi|449443552|ref|XP_004139541.1| (PREDICTED: mitochondrial import inner membrane translocase subunit tim16 [Cucumis sativus]) HSP 1 Score: 78.6 bits (192), Expect = 5.3e-12 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|