CU144029 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTGCTTCATCCAGCTCGGAGCTCCAATGGATCTCCATTTTCATGCCGATTTTCTGCGTTTTGCCTTTTTTCTCTAGACCTTCCTTTTGAAGATCAATGGAGTGGTCATCTCGCAGTCTCAGATACACGGCCACACACCAATTTGGCTGCCATTGCCTTACGCAGTTACGTGCTATTA
BLAST of CU144029 vs. TrEMBL
Match: A0A0A0KAK9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G447840 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 4.5e-13 Identity = 41/43 (95.35%), Postives = 41/43 (95.35%), Query Frame = -3
BLAST of CU144029 vs. NCBI nr
Match: gi|700190189|gb|KGN45422.1| (hypothetical protein Csa_7G447840 [Cucumis sativus]) HSP 1 Score: 81.3 bits (199), Expect = 6.4e-13 Identity = 41/43 (95.35%), Postives = 41/43 (95.35%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|